Predicted mutation
evidence seq id position mutation annotation gene description
JC NC_002947 4,980,585 +GGC intergenic (‑24/+44) PP_4387 ← / ← flgE hypothetical protein/flagellar hook protein FlgE

New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_002947 = 49805850 (0.000)40 (0.770)
+GGC
35/278 0.7 100% intergenic (‑24/+44) PP_4387/flgE hypothetical protein/flagellar hook protein FlgE
?NC_002947 4980586 = 0 (0.000)intergenic (‑25/+43) PP_4387/flgE hypothetical protein/flagellar hook protein FlgE

CCGAACACAGGTAGCGGCCGGTGACCAGGCTTTGCCATTGATAGAACGGGGCGGGGGCAGCGGGGGCAGGCAGAACCAGCACCAGCAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGCGCTTTGCGGCCCCAATTACAAACACCAAAGCCAATACAATCATCAGGTCATCTGAATGATGGTCTGCATGATGGTGCTTTCAGTGGAAATGGTCTTGGCATTGGCCTGGTAGTTGCTCTGCGCCTTGATCAGGTTTACCAGCTCGC  >  NC_002947/4980441‑4980732
                                                                                                                                                |                                                                                                                                                   
ccGAACACAGGTAGCGGCCGGTGACCAGGCTTTGCCATTGATAGAACGGGGCGGGGGCAGCGGGGGCAGGCAGAACCAGCACCAGCAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggcc                                                                                                                                                 >  7:104549‑M1/1‑145 (MQ=255)
      acaGGTAGCGGCCGGTGACCAGGCTTTGCCATTGATAGAACGGGGCGGGGGCAGCGGGGGCAGGCAGAACCAGCACCAGCAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttg                                                                                                                                           >  7:130910‑M1/1‑139 (MQ=255)
      aaaggTAGCGGCCGGTCCCCAGGCATTGCCATTTATAGAACTGGGCGGGGGCAGCGGGGGCAGGCAGAACCACCACCAGCAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttg                                                                                                                                           <  8:130910‑M1/147‑11 (MQ=255)
        aGGTAGCGGCGGGTTACCAGGCTTTGCCATTTATAGAACGGGGCGTGGGAATCGTGGGCAGGCAGAACCAGGACGAGCAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcg                                                                                                                                         <  8:97153‑M1/149‑13 (MQ=255)
               ggCCGGTGACCAGGCTTTGCCATTGATAGAACGGGGCGGGGGCAGCGGGGGCAGGCAGAACCAGCACCAGCAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaa                                                                                                                                  >  2:262271‑M1/1‑130 (MQ=255)
               ggCCGGTGACCAGGCTTTGCCATTGATAGAACGGGGCGGGGGCAGCGGGGGCAGGCAGAACCAGCACCAGCAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgcaaagcggccccaa                                                                                                                                  <  8:217734‑M1/149‑20 (MQ=255)
                       aCCAGGCTTTGCCATTGATAGAACGGGGCGGGGGCAGCGGGGGCAGGCAGAACCAGCACCAGCAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaa                                                                                                                           <  5:140082‑M1/148‑27 (MQ=255)
                        ccAGGCTGTGCCATTGATAGACCGGGGCGGGGGCAGCGGGGGCAGGCAGAACCAGCACCAGCAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaaca                                                                                                                         <  2:284997‑M1/149‑29 (MQ=255)
                                tGCCATTGATAGAACGGGCCGGGGGCAGCGGGGGCAGGCAGAACCAGCACCAGCAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagc                                                                                                                  <  8:254268‑M1/148‑36 (MQ=255)
                                    aTTGATAGAACGGGGCGGGGGCAGCGGGGGCAGGCAGAACCAGCACCAGCAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaat                                                                                                              >  2:1524‑M1/1‑109 (MQ=255)
                                                       ggcagcgggggcagGCAGAACCAGCACCAGCAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctg                                                                                           >  4:257294‑M1/1‑90 (MQ=255)
                                                              ggggcagGCAGAACCAGCACCAGCAAGAGGTACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatgg                                                                                   >  4:218373‑M1/1‑83 (MQ=255)
                                                                      cagAACCAGCACCAGCAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcaa                                                                            >  2:249276‑M1/1‑75 (MQ=255)
                                                                          accagcaccagcAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatgg                                                                       >  3:95364‑M1/1‑71 (MQ=255)
                                                                          accagcaccagcAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatg                                                                                    >  8:71270‑M1/1‑71 (MQ=255)
                                                                           ccagcaccagcaAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatgtt                                                                      >  8:266494‑M1/1‑70 (MQ=255)
                                                                           ccagcaccagcaAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatg                                                                                    >  1:149504‑M1/1‑70 (MQ=255)
                                                                           ccagcaccagcaAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatg                                                                                    <  2:149504‑M1/135‑66 (MQ=255)
                                                                                accagcaAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgcgttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgcttt                                                                 >  1:156896‑M1/1‑65 (MQ=255)
                                                                                    gcaAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagt                                                             >  2:250545‑M1/1‑61 (MQ=255)
                                                                                     caAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgaaggtctgcatgatggtgctttcagtg                                                            <  2:289530‑M1/149‑90 (MQ=255)
                                                                                       agtgtaacaaggCCAGTAACGACAGCCGCTTCATTCTCGTGAACCTTCACATTCTTGGgtgcgatttgcggccccaattacaaacaccttcagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtg                                                           <  1:249276‑M1/143‑91 (MQ=255)
                                                                                        ggggAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaa                                                         <  4:95364‑M1/149‑93 (MQ=255)
                                                                                             aCAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaaatggt                                                    <  1:262271‑M1/149‑98 (MQ=255)
                                                                                              aaagGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaaattgtc                                                   <  8:9540‑M1/148‑99 (MQ=255)
                                                                                               aaGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatccaatcatcaggtcagctgtatgatggtgtgcatgatggtggtttgaggggaaatggtct                                                  >  8:110801‑M1/1‑50 (MQ=255)
                                                                                                aGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaaatggtctt                                                 <  1:1524‑M1/149‑101 (MQ=255)
                                                                                                 ggCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaaatggtcttg                                                <  3:218373‑M1/149‑102 (MQ=255)
                                                                                                    cAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaaatggtcttggca                                             >  5:291607‑M1/1‑45 (MQ=255)
                                                                                                       tAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaaacatcaggtcatattaatgatggtctgcatgatggtgctttaagtggaaatggtgttggcattt                                          >  6:27348‑M1/1‑42 (MQ=255)
                                                                                                           gACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaaatggtcttggcattggcct                                      <  3:257294‑M1/149‑112 (MQ=255)
                                                                                                                                aaCCTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaaatggtcttggcattggcctggtagttgctctgcgccttg                  <  5:27348‑M1/148‑132 (MQ=255)
                                                                                                                                   cTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaaatggtcttggcattggcctggtagttgctctgcgccttgat                >  1:130676‑M1/1‑14 (MQ=255)
                                                                                                                                   cTTCACATTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttaagtggaaatggtcttggcattggcctggtagttgctctgcgccttgat                >  5:50388‑M1/1‑14 (MQ=255)
                                                                                                                                      cacaTTCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaaatggtcttggcattggcctggtagttgctctgcgccttgatcagg            <  1:250545‑M1/148‑138 (MQ=255)
                                                                                                                                         aTTCTTGGggccgctttgcggccccaattacaaacaccaaagcctatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaaatggtcttggcattggcctggtagttgctctgcgccttgatcaggttta        >  5:220730‑M1/1‑8 (MQ=255)
                                                                                                                                          ttCTTGGggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaaatggtcttggcattggcctggtagttgctctgcgccttgatcaggtttac       <  7:266494‑M1/149‑143 (MQ=255)
                                                                                                                                             ttGGggccgcaaagcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaaatggtcttggcattggcctggtagttgctctgcgccttgatcaggtttaccag    >  4:259052‑M1/1‑4 (MQ=255)
                                                                                                                                             ttGGggccgcaaagcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaaatggtcttggcattggcctggtagttgctctgcgccttgatcaggtttaccag    >  4:167753‑M1/1‑4 (MQ=255)
                                                                                                                                               ggggccgctttgcggccccaattacaaacaccaaagccaatacaatcatcaggtcatctgaatgatggtctgcatgatggtgctttcagtggaaatggtcttggcattggcctggtagttgctctgcgccttgatcaggtttaccagct  >  8:69037‑M1/1‑2 (MQ=255)
                                                                                                                                                |                                                                                                                                                   
CCGAACACAGGTAGCGGCCGGTGACCAGGCTTTGCCATTGATAGAACGGGGCGGGGGCAGCGGGGGCAGGCAGAACCAGCACCAGCAAGGGGAACAAGGCCAGTAACGACAGCCGCTTCATTCGCGTGAACCTTCACATTCTTGGCGCTTTGCGGCCCCAATTACAAACACCAAAGCCAATACAATCATCAGGTCATCTGAATGATGGTCTGCATGATGGTGCTTTCAGTGGAAATGGTCTTGGCATTGGCCTGGTAGTTGCTCTGCGCCTTGATCAGGTTTACCAGCTCGC  >  NC_002947/4980441‑4980732

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 15 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap:     Deleted base: 
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.