breseq  version 0.35.4  revision f352f80f4bc9 mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence	position	mutation	freq	annotation	gene	description
RA	4,701	T→A	15.0%	L323Q (CTG→CAG)	thrC →	L‑threonine synthase
RA	5,144	G→A	100%	intergenic (+124/‑90)	thrC → / → yaaX	L‑threonine synthase/DUF2502 family putative periplasmic protein
RA	7,522	G→T	100%	F146L (TTC→TTA)	yaaJ ←	putative transporter
RA	10,444	G→T	100%	F17L (TTC→TTA)	satP ←	succinate‑acetate transporter
RA	12,901	G→A	100%	D247N (GAT→AAT)	dnaK →	chaperone Hsp70, with co‑chaperone DnaJ
RA	13,962	A→C	22.8%	E600D (GAA→GAC)	dnaK →	chaperone Hsp70, with co‑chaperone DnaJ
RA	23,320	T→A	58.8%	F310L (TTT→TTA)	ileS →	isoleucyl‑tRNA synthetase
RA	24,012	A→T	8.5%	H541L (CAC→CTC)	ileS →	isoleucyl‑tRNA synthetase
RA	24,783	T→A	25.5%	L798Q (CTG→CAG)	ileS →	isoleucyl‑tRNA synthetase
RA	25,546	G→T	100%	D114Y (GAC→TAC)	lspA →	prolipoprotein signal peptidase (signal peptidase II)
RA	27,307	C→T	100%	I5I (ATC→ATT)	rihC →	ribonucleoside hydrolase 3
RA	29,139	G→T	100%	G256C (GGT→TGT)	dapB →	dihydrodipicolinate reductase
RA	31,710	C→A	100%	I298I (ATC→ATA)	carB →	carbamoyl‑phosphate synthase large subunit
RA	31,718	A→C	8.4%	N301T (AAC→ACC)	carB →	carbamoyl‑phosphate synthase large subunit
RA	32,659	C→A	100%	R615S (CGC→AGC)	carB →	carbamoyl‑phosphate synthase large subunit
RA	32,802	C→A	100%	I662I (ATC→ATA)	carB →	carbamoyl‑phosphate synthase large subunit
RA	40,957	C→A	100%	V325V (GTG→GTT)	caiT ←	putative transporter
RA	42,150	G→A	100%	intergenic (‑219/‑253)	caiT ← / → fixA	putative transporter/anaerobic carnitine reduction putative electron transfer flavoprotein subunit
RA	42,342	G→T	12.8%	intergenic (‑411/‑61)	caiT ← / → fixA	putative transporter/anaerobic carnitine reduction putative electron transfer flavoprotein subunit
RA	49,840	G→T	100%	A6A (GCG→GCT)	folA →	dihydrofolate reductase
RA	54,392	G→T	100%	A104E (GCG→GAG)	surA ←	peptidyl‑prolyl cis‑trans isomerase (PPIase)
RA	55,590	G→T	100%	T507K (ACG→AAG)	lptD ←	LPS assembly OM complex LptDE, beta‑barrel component
RA	56,677	G→T	100%	R145S (CGC→AGC)	lptD ←	LPS assembly OM complex LptDE, beta‑barrel component
RA	58,723	G→T	71.3%	pseudogene (250/579 nt)	yabP →	pseudogene, pentapeptide repeats‑containing
RA	59,320	A→T	57.7%	intergenic (+41/+367)	yabP → / ← rluA	pseudogene, pentapeptide repeats‑containing/dual specificity 23S rRNA pseudouridine(746), tRNA pseudouridine(32) synthase, SAM‑dependent
RA	61,967	A→C	27.0%	L433R (CTG→CGG)	rapA ←	RNA polymerase remodeling/recycling factor ATPase; RNA polymerase‑associated, ATP‑dependent RNA translocase
RA	68,546	C→A	22.2%	R237S (CGC→AGC)	yabI →	DedA family inner membrane protein
RA	76,821	G→T	100%	G177G (GGC→GGA)	leuC ←	3‑isopropylmalate dehydratase large subunit
RA	78,007	C→A	27.2%	G147C (GGT→TGT)	leuB ←	3‑isopropylmalate dehydrogenase, NAD(+)‑dependent
RA	80,123	C→T	100%	G25S (GGC→AGC)	leuL ←	leu operon leader peptide
RA	81,562	C→A	100%	I236I (ATC→ATA)	leuO →	global transcription factor
RA	82,037	C→T	100%	intergenic (+238/‑80)	leuO → / → ilvI	global transcription factor/acetolactate synthase 3 large subunit
RA	88,635	C→A	14.0%	R246S (CGC→AGC)	ftsI →	transpeptidase involved in septal peptidoglycan synthesis (penicillin‑binding protein 3)
RA	93,391	G→T	100%	T301T (ACG→ACT)	mraY →	phospho‑N‑acetylmuramoyl‑pentapeptide transferase
RA	94,963	C→A	24.7%	A25E (GCG→GAG)	ftsW →	lipid II flippase; integral membrane protein involved in stabilizing FstZ ring during cell division
RA	97,521	C→A	100%	A90A (GCC→GCA)	murC →	UDP‑N‑acetylmuramate:L‑alanine ligase
RA	102,736	C→A	100%	I315I (ATC→ATA)	ftsZ →	GTP‑binding tubulin‑like cell division protein
RA	102,769	G→T	100%	V326V (GTG→GTT)	ftsZ →	GTP‑binding tubulin‑like cell division protein
RA	103,352	C→A	60.0%	I103I (ATC→ATA)	lpxC →	UDP‑3‑O‑acyl N‑acetylglucosamine deacetylase
RA	103,467	G→T	100%	D142Y (GAT→TAT)	lpxC →	UDP‑3‑O‑acyl N‑acetylglucosamine deacetylase
RA	104,561	G→T	100%	A124S (GCG→TCG)	secM →	regulator of secA translation
RA	108,039	C→A	100%	intergenic (+119/+97)	mutT → / ← yacG	nucleoside triphosphate pyrophosphohydrolase, marked preference for dGTP/DNA gyrase inhibitor
RA	108,648	Δ1 bp	100%	coding (439/744 nt)	zapD ←	FtsZ stabilizer
RA	118,548	G→A	22.5%	intergenic (‑510/‑31)	aroP ← / → pdhR	aromatic amino acid transporter/pyruvate dehydrogenase complex repressor; autorepressor
RA	118,873	G→T	100%	D99Y (GAC→TAC)	pdhR →	pyruvate dehydrogenase complex repressor; autorepressor
RA	119,536	G→T	100%	P11P (CCG→CCT)	aceE →	pyruvate dehydrogenase, decarboxylase component E1, thiamine triphosphate‑binding
JC	123,063	(GCAGCGCCTGCGGCAGCTCCTGCGAAACAGGAAGCG)1→2	5.6%	coding (882/1893 nt)	aceF →	pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2
RA	134,028	G→T	100%	A153A (GCG→GCT)	cueO →	multicopper oxidase (laccase)
RA	134,297	C→A	25.6%	S243* (TCG→TAG)	cueO →	multicopper oxidase (laccase)
RA	135,689	A→T	69.1%	L675Q (CTG→CAG)	gcd ←	glucose dehydrogenase
RA	137,071	G→T	100%	I214I (ATC→ATA)	gcd ←	glucose dehydrogenase
RA	137,915	G→T	100%	intergenic (‑203/‑3)	gcd ← / → hpt	glucose dehydrogenase/hypoxanthine phosphoribosyltransferase
RA	141,522	G→T	6.9%	intergenic (+18/‑46)	yadI → / → yadE	putative PTS Enzyme IIA/putative polysaccharide deacetylase lipoprotein
RA	142,460	T→A	100%	F298Y (TTC→TAC)	yadE →	putative polysaccharide deacetylase lipoprotein
RA	145,641	A→T	7.0%	Y150N (TAC→AAC)	panB ←	3‑methyl‑2‑oxobutanoate hydroxymethyltransferase
RA	145,894	G→T	12.2%	I65I (ATC→ATA)	panB ←	3‑methyl‑2‑oxobutanoate hydroxymethyltransferase
RA	150,452	C→A	24.6%	E488* (GAA→TAA)	htrE ←	putative outer membrane usher protein
RA	153,472	G→T	100%	intergenic (‑102/+268)	yadN ← / ← folK	putative fimbrial‑like adhesin protein/2‑amino‑4‑hydroxy‑6‑hydroxymethyldihyropteridine pyrophosphokinase
RA	158,287	C→A	100%	D78Y (GAC→TAC)	ligT ←	2'‑5' RNA ligase
RA	159,666	G→T	100%	G359C (GGT→TGT)	hrpB →	putative ATP‑dependent helicase
RA	161,068	A→C	28.9%	intergenic (+47/‑149)	hrpB → / → mrcB	putative ATP‑dependent helicase/fused glycosyl transferase and transpeptidase
RA	165,759	G→T	57.1%	E597* (GAG→TAG)	fhuA →	ferrichrome outer membrane transporter
RA	166,411	T→A	54.5%	G49G (GGT→GGA)	fhuC →	iron‑hydroxamate transporter subunit
RA	166,662	C→A	100%	S133* (TCG→TAG)	fhuC →	iron‑hydroxamate transporter subunit
RA	167,932	G→T	13.8%	A291S (GCC→TCC)	fhuD →	iron‑hydroxamate transporter subunit
RA	168,584	A→T	55.5%	L212F (TTA→TTT)	fhuB →	fused iron‑hydroxamate transporter subunits of ABC superfamily: membrane components
RA	173,725	G→T	100%	G129G (GGC→GGA)	yadS ←	UPF0126 family inner membrane protein
RA	176,783	G→T	100%	D354Y (GAT→TAT)	dgt →	deoxyguanosine triphosphate triphosphohydrolase
RA	185,393	A→T	100%	F201I (TTC→ATC)	map ←	methionine aminopeptidase
RA	186,159	A→G	100%	intergenic (‑166/‑40)	map ← / → tff	methionine aminopeptidase/novel sRNA, function unknown
RA	190,772	G→T	7.2%	V255V (GTG→GTT)	dxr →	1‑deoxy‑D‑xylulose 5‑phosphate reductoisomerase
RA	193,157	T→C	10.4%	I42T (ATA→ACA)	rseP →	inner membrane zinc RIP metalloprotease; RpoE activator, by degrading RseA; cleaved signal peptide endoprotease
RA	196,832	C→A	100%	I806I (ATC→ATA)	bamA →	BamABCDE complex OM biogenesis outer membrane pore‑forming assembly factor
RA	199,229	G→T	100%	E61D (GAG→GAT)	lpxA →	UDP‑N‑acetylglucosamine acetyltransferase
RA	201,962	A→T	100%	D117V (GAT→GTT)	dnaE →	DNA polymerase III alpha subunit
RA	208,013	G→T	100%	M616I (ATG→ATT)	ldcC →	lysine decarboxylase 2, constitutive
RA	212,137	G→T	18.3%	E128* (GAA→TAA)	nlpE →	lipoprotein involved with copper homeostasis and adhesion
RA	214,084	G→T	100%	G393G (GGC→GGA)	proS ←	prolyl‑tRNA synthetase
RA	216,136	G→T	25.8%	P116Q (CCA→CAA)	rcsF ←	putative outer membrane protein
RA	217,887	C→T	100%	W74* (TGG→TGA)	metI ←	DL‑methionine transporter subunit
RA	217,932	A→C	100%	I59M (ATT→ATG)	metI ←	DL‑methionine transporter subunit
RA	223,096	C→A	13.7%	noncoding (851/2904 nt)	rrlH →	23S ribosomal RNA of rrnH operon
RA	229,915	C→A	26.2%	M176I (ATG→ATT)	mltD ←	putative membrane‑bound lytic murein transglycosylase D
RA	230,579	C→T	100%	E231K (GAA→AAA)	gloB ←	hydroxyacylglutathione hydrolase
RA	231,378	C→A	100%	R26S (CGC→AGC)	yafS →	putative S‑adenosyl‑L‑methionine‑dependent methyltransferase
RA	232,860	G→T	100%	D103Y (GAT→TAT)	dnaQ →	DNA polymerase III epsilon subunit
RA	234,984	G→T	7.2%	I80I (ATC→ATA) ‡	ykfM ←	lethality reduction protein, putative inner membrane protein
RA	234,985	A→T	8.8%	I80N (ATC→AAC) ‡	ykfM ←	lethality reduction protein, putative inner membrane protein
RA	234,990	G→T	9.7%	F78L (TTC→TTA)	ykfM ←	lethality reduction protein, putative inner membrane protein
RA	234,994	G→T	13.9%	S77* (TCA→TAA)	ykfM ←	lethality reduction protein, putative inner membrane protein
RA	235,006	G→T	8.1%	T73K (ACG→AAG)	ykfM ←	lethality reduction protein, putative inner membrane protein
RA	235,010	G→T	12.6%	L72I (CTT→ATT)	ykfM ←	lethality reduction protein, putative inner membrane protein
RA	235,019	C→A	13.0%	V69L (GTA→TTA)	ykfM ←	lethality reduction protein, putative inner membrane protein
RA	235,022	G→T	7.9%	H68N (CAT→AAT)	ykfM ←	lethality reduction protein, putative inner membrane protein
RA	235,036	G→T	10.4%	S63Y (TCC→TAC)	ykfM ←	lethality reduction protein, putative inner membrane protein
RA	236,234	A→T	100%	V148E (GTG→GAG)	yafV ←	putative NAD(P)‑binding C‑N hydrolase family amidase
RA	237,417	A→C	68.1%	F792V (TTT→GTT)	fadE ←	acyl coenzyme A dehydrogenase
RA	238,195	G→T	100%	V532V (GTC→GTA)	fadE ←	acyl coenzyme A dehydrogenase
RA	238,303	A→T	26.7%	V496V (GTT→GTA)	fadE ←	acyl coenzyme A dehydrogenase
RA	239,583	C→A	29.1%	A70S (GCG→TCG)	fadE ←	acyl coenzyme A dehydrogenase
RA	245,020	G→T	13.4%	pseudogene (1538/1713 nt)	lfhA ←	pseudogene, flagellar system protein, promoterless fragment; flagellar biosynthesis
RA	245,058	G→T	27.9%	pseudogene (1500/1713 nt)	lfhA ←	pseudogene, flagellar system protein, promoterless fragment; flagellar biosynthesis
RA	245,306	C→A	70.7%	pseudogene (1252/1713 nt)	lfhA ←	pseudogene, flagellar system protein, promoterless fragment; flagellar biosynthesis
RA	248,447	C→T	100%	intergenic (+7/‑45)	dinB → / → yafN	DNA polymerase IV/antitoxin of the YafO‑YafN toxin‑antitoxin system
RA	248,486	C→A	100%	intergenic (+46/‑6)	dinB → / → yafN	DNA polymerase IV/antitoxin of the YafO‑YafN toxin‑antitoxin system
RA	248,529	C→T	30.9%	T13I (ACT→ATT)	yafN →	antitoxin of the YafO‑YafN toxin‑antitoxin system
RA	249,008	T→A	7.0%	L74* (TTG→TAG)	yafO →	mRNA interferase toxin of the YafO‑YafN toxin‑antitoxin system
RA	250,909	A→T	100%	L432Q (CTG→CAG)	pepD ←	aminoacyl‑histidine dipeptidase (peptidase D)
RA	252,850	C→T	7.3%	I129I (ATC→ATT)	gpt →	xanthine phosphoribosyltransferase; xanthine‑guanine phosphoribosyltransferase
RA	253,855	G→T	100%	R281L (CGT→CTT)	frsA →	fermentation‑respiration switch protein; PTS Enzyme IIA(Glc)‑binding protein; pNP‑butyrate esterase activity
RA	255,301	G→T	7.4%	Q171K (CAA→AAA)	phoE ←	outer membrane phosphoporin protein E
RA	255,487	A→T	100%	S109T (TCT→ACT)	phoE ←	outer membrane phosphoporin protein E
RA	257,734	A→T	12.5%	Q174L (CAG→CTG)	proA →	gamma‑glutamylphosphate reductase
RA	259,494	G→T	100%	C75* (TGC→TGA)	yafW ←	CP4‑6 prophage; antitoxin of the YkfI‑YafW toxin‑antitoxin system
RA	262,114	C→A	100%	D51Y (GAT→TAT)	yafY ←	lipoprotein, inner membrane; overproduction stimulates degP expression; CP4‑6 prophage
RA	274,735	A→T	100%	pseudogene (138/348 nt)	afuB ←	pseudogene, CP4‑6 prophage; ABC transporter permease family;Phage or Prophage Related
RA	277,970	G→A	6.4%	intergenic (‑276/‑19)	yagA ← / → yagE	CP4‑6 prophage; putative DNA‑binding transcriptional regulator/2‑keto‑3‑deoxy gluconate (KDG) aldolase; CP4‑6 prophage
RA	279,098	G→T	23.7%	E63* (GAG→TAG)	yagF →	CP4‑6 prophage; dehydratase family protein
RA	279,334	C→A	100%	I141I (ATC→ATA)	yagF →	CP4‑6 prophage; dehydratase family protein
RA	279,800	G→T	100%	E297* (GAA→TAA)	yagF →	CP4‑6 prophage; dehydratase family protein
RA	280,968	G→T	60.6%	intergenic (+89/‑138)	yagF → / → yagG	CP4‑6 prophage; dehydratase family protein/CP4‑6 prophage; putative sugar transporter
RA	282,700	G→T	6.9%	P67P (CCG→CCT)	yagH →	CP4‑6 prophage; putative xylosidase/arabinosidase
RA	285,966	A→T	12.7%	P17P (CCT→CCA)	argF ←	ornithine carbamoyltransferase 2, chain F; CP4‑6 prophage
RA	288,249	T→A	100%	T137T (ACA→ACT)	yagK ←	CP4‑6 prophage; conserved protein
RA	290,012	C→T	100%	D167N (GAT→AAT)	yagM ←	CP4‑6 prophage; uncharacterized protein
RA	291,348	G→A	100%	intergenic (‑58/+59)	yagN ← / ← intF	CP4‑6 prophage; uncharacterized protein/CP4‑6 prophage; putative phage integrase
RA	294,795	C→A	25.2%	L617L (CTG→CTT)	paoC ←	PaoABC aldehyde oxidoreductase, Moco‑containing subunit
RA	294,929	C→A	100%	E573* (GAA→TAA)	paoC ←	PaoABC aldehyde oxidoreductase, Moco‑containing subunit
RA	299,522	G→T	7.9%	intergenic (+206/+42)	yagU → / ← ykgJ	DUF1440 family inner membrane protein/UPF0153 cysteine cluster protein
RA	300,770	C→A	100%	V49V (GTG→GTT)	ecpE ←	ECP production pilus chaperone
RA	302,428	G→T	100%	P34Q (CCG→CAG)	ecpD ←	polymerized tip adhesin of ECP fibers
RA	307,479	G→A	100%	intergenic (‑432/‑344)	ecpR ← / → ykgL	putative transcriptional regulator for the ecp operon/uncharacterized protein
RA	309,680	C→T	9.5%	intergenic (‑164/‑388)	ykgP ← / → eaeH	pseudogene, oxidoreductase family/pseudogene, attaching and effacing protein homology;factor; Not classified
RA	312,532	G→A	100%	pseudogene (349/684 nt)	ykgA ←	pseudogene, AraC family;putative regulator; Not classified; putative ARAC‑type regulatory protein
RA	314,566	C→A	100%	D383Y (GAT→TAT)	rclA ←	reactive chlorine stress species (RCS) resistance protein; pyridine nucleotide‑dependent disulfide oxidoreductase family
RA	317,105	T→A	60.3%	intergenic (+313/‑214)	rclR → / → ykgE	reactive chlorine species (RCS)‑specific activator of the rcl genes/cysteine‑rich LutA family protein; putative electron transport chain YkgEFG component
RA	317,203	G→A	100%	intergenic (+411/‑116)	rclR → / → ykgE	reactive chlorine species (RCS)‑specific activator of the rcl genes/cysteine‑rich LutA family protein; putative electron transport chain YkgEFG component
RA	317,205	G→A	100%	intergenic (+413/‑114)	rclR → / → ykgE	reactive chlorine species (RCS)‑specific activator of the rcl genes/cysteine‑rich LutA family protein; putative electron transport chain YkgEFG component
RA	317,206	G→A	25.5%	intergenic (+414/‑113)	rclR → / → ykgE	reactive chlorine species (RCS)‑specific activator of the rcl genes/cysteine‑rich LutA family protein; putative electron transport chain YkgEFG component
RA	319,024	C→A	100%	R326S (CGC→AGC)	ykgF →	ferridoxin‑like LutB family protein; putative electron transport chain YkgEFG component
RA	319,381	G→T	100%	D445Y (GAC→TAC)	ykgF →	ferridoxin‑like LutB family protein; putative electron transport chain YkgEFG component
RA	320,920	G→A	100%	S52S (AGC→AGT)	ykgH ←	putative inner membrane protein
RA	321,223	C→A	100%	intergenic (‑148/+65)	ykgH ← / ← betA	putative inner membrane protein/choline dehydrogenase, a flavoprotein
RA	325,740	G→T	57.8%	P189P (CCG→CCT)	betT →	choline transporter of high affinity
RA	327,051	A→T	26.4%	E626D (GAA→GAT)	betT →	choline transporter of high affinity
RA	329,372	A→T	100%	L258Q (CTG→CAG)	yahB ←	putative DNA‑bindng transcriptional regulator
RA	332,599	G→T	100%	A37A (GCG→GCT)	yahF →	putative NAD(P)‑binding succinyl‑CoA synthase
RA	332,897	G→T	59.9%	D137Y (GAT→TAT)	yahF →	putative NAD(P)‑binding succinyl‑CoA synthase
RA	335,247	C→A	100%	N404K (AAC→AAA)	yahG →	DUF1116 family protein
RA	337,720	G→T	100%	E295D (GAG→GAT)	yahJ →	putative metallo‑dependent hydrolase domain deaminase
RA	339,348	G→T	24.5%	D252Y (GAC→TAC)	yahK →	aldehyde reductase, NADPH‑dependent, Zn‑containing, broad specificity
RA	344,800	G→T	100%	E136D (GAG→GAT)	prpB →	2‑methylisocitrate lyase
RA	350,055	G→T	6.6%	D547Y (GAC→TAC)	prpE →	propionate‑‑CoA ligase
RA	350,559	G→T	29.0%	intergenic (+256/‑74)	prpE → / → codB	propionate‑‑CoA ligase/cytosine transporter
RA	353,486	A→T	5.9%	intergenic (+321/+16)	codA → / ← cynR	cytosine/isoguanine deaminase/transcriptional activator of cyn operon; autorepressor
RA	360,156	C→G	7.2%	intergenic (‑90/+505)	lacZ ← / ← lacI	pseudogene, truncated/DNA‑binding transcriptional repressor
RA	360,173	C→A	6.4%	intergenic (‑107/+488)	lacZ ← / ← lacI	pseudogene, truncated/DNA‑binding transcriptional repressor
RA	360,752	A→G	100%	V331A (GTG→GCG)	lacI ←	DNA‑binding transcriptional repressor
RA	360,969	C→A	15.5%	E259* (GAG→TAG)	lacI ←	DNA‑binding transcriptional repressor
RA	360,995	G→T	41.8%	A250E (GCG→GAG)	lacI ←	DNA‑binding transcriptional repressor
JC	361,139	+GCCA	12.0%	coding (605/1083 nt)	lacI ←	DNA‑binding transcriptional repressor
RA	361,692	G→T	36.4%	Q18K (CAG→AAG)	lacI ←	DNA‑binding transcriptional repressor
RA	361,806	G→A	100%	intergenic (‑63/+14)	lacI ← / ← mhpR	DNA‑binding transcriptional repressor/mhp operon transcriptional activator
RA	362,159	G→T	100%	I165I (ATC→ATA)	mhpR ←	mhp operon transcriptional activator
RA	362,629	A→T	100%	Y9N (TAC→AAC)	mhpR ←	mhp operon transcriptional activator
RA	364,561	G→T	100%	D18Y (GAC→TAC)	mhpB →	2,3‑dihydroxyphenylpropionate 1,2‑dioxygenase
RA	372,091	C→A	100%	R393R (CGG→AGG)	mhpT →	3‑hydroxyphenylpropionic transporter
RA	372,581	G→T	100%	A118A (GCG→GCT)	yaiL →	DUF2058 family protein
RA	378,179	A→T	100%	pseudogene (150/282 nt)	yaiX ←	pseudogene, interrupted by IS2A, acetyltransferase homolog; nonfunctional; interruped by IS2; putative transferase
RA	385,815	G→T	100%	pseudogene (109/1458 nt)	yaiT →	pseudogene, autotransporter family;putative structure; Not classified; interrupted by IS3; putative flagellin structural protein
RA	390,551	T→G	100%	L197R (CTG→CGG)	yaiV →	putative transcriptional regulator
RA	396,883	A→G	100%	Q14Q (CAA→CAG)	iraP →	anti‑RssB factor, RpoS stabilzer during Pi starvation; anti‑adapter protein
RA	397,959	G→A	100%	A253T (GCG→ACG)	phoA →	bacterial alkaline phosphatase
RA	400,594	G→T	100%	V169V (GTC→GTA)	proC ←	pyrroline‑5‑carboxylate reductase, NAD(P)‑binding
RA	402,340	G→T	100%	V160V (GTG→GTT)	aroL →	shikimate kinase II
RA	404,712	A→T	26.0%	F255Y (TTC→TAC)	rdgC ←	nucleoid‑associated ssDNA and dsDNA binding protein; competitive inhibitor of RecA function
RA	406,075	C→A	100%	P159Q (CCG→CAG)	mak →	manno(fructo)kinase
RA	407,711	G→T	12.2%	A76E (GCG→GAG)	araJ ←	arabinose‑inducible putative transporter, MFS family
RA	411,027	G→T	100%	L61L (CTC→CTA)	sbcC ←	exonuclease, dsDNA, ATP‑dependent
RA	411,556	C→A	24.6%	D285Y (GAT→TAT)	sbcD ←	exonuclease, dsDNA, ATP‑dependent
RA	412,004	A→T	5.5%	R135R (CGT→CGA)	sbcD ←	exonuclease, dsDNA, ATP‑dependent
RA	415,049	G→T	24.4%	M1M (ATG→ATT) †	brnQ →	branched‑chain amino acid transport system 2 carrier protein; LIV‑II transport system for Ile, Leu, and Val
RA	421,799	C→A	100%	I69I (ATC→ATA)	tgt →	tRNA‑guanine transglycosylase
RA	424,393	G→T	5.7%	A431S (GCG→TCG)	secD →	SecYEG protein translocase auxillary subunit
RA	425,143	G→T	100%	T61T (ACG→ACT)	secF →	SecYEG protein translocase auxillary subunit
RA	426,157	G→T	100%	E33* (GAG→TAG)	yajD →	HNH nuclease family protein
RA	427,575	A→G	25.4%	intergenic (‑106/+193)	tsx ← / ← yajI	nucleoside channel, receptor of phage T6 and colicin K/putative lipoprotein
RA	430,523	G→A	25.1%	A141T (GCA→ACA)	ribE →	riboflavin synthase beta chain
RA	432,762	G→T	100%	P277Q (CCG→CAG)	yajO ←	2‑carboxybenzaldehyde reductase
RA	433,551	G→T	100%	S14Y (TCC→TAC)	yajO ←	2‑carboxybenzaldehyde reductase
RA	434,663	A→C	100%	I324S (ATC→AGC)	dxs ←	1‑deoxyxylulose‑5‑phosphate synthase, thiamine triphosphate‑binding, FAD‑requiring
RA	435,336	G→T	100%	Q100K (CAG→AAG)	dxs ←	1‑deoxyxylulose‑5‑phosphate synthase, thiamine triphosphate‑binding, FAD‑requiring
RA	435,862	A→T	100%	T232T (ACT→ACA)	ispA ←	geranyltranstransferase
RA	437,672	T→A	100%	V223E (GTG→GAG)	thiI →	tRNA s(4)U8 sulfurtransferase
RA	444,489	G→A	100%	R537C (CGT→TGT)	cyoB ←	cytochrome o ubiquinol oxidase subunit I
RA	446,369	T→G	100%	Q233P (CAG→CCG)	cyoA ←	cytochrome o ubiquinol oxidase subunit II
RA	449,423	G→T	10.2%	I67I (ATC→ATA)	yajG ←	putative lipoprotein
RA	450,290	G→A	100%	intergenic (+45/‑299)	bolA → / → tig	stationary‑phase morphogene, transcriptional repressor for mreB; also regulator for dacA, dacC, and ampC/peptidyl‑prolyl cis/trans isomerase (trigger factor)
RA	450,333	A→T	6.8%	intergenic (+88/‑256)	bolA → / → tig	stationary‑phase morphogene, transcriptional repressor for mreB; also regulator for dacA, dacC, and ampC/peptidyl‑prolyl cis/trans isomerase (trigger factor)
RA	450,766	G→T	100%	A60S (GCG→TCG)	tig →	peptidyl‑prolyl cis/trans isomerase (trigger factor)
RA	456,298	T→A	100%	L652Q (CTG→CAG)	lon →	DNA‑binding ATP‑dependent protease La
RA	456,588	G→T	100%	D749Y (GAC→TAC)	lon →	DNA‑binding ATP‑dependent protease La
RA	459,325	T→A	22.5%	intergenic (+83/‑68)	ppiD → / → ybaV	periplasmic folding chaperone, has an inactive PPIase domain/putative competence‑suppressing periplasmic helix‑hairpin‑helix DNA‑binding protein
RA	461,499	G→T	100%	R424S (CGC→AGC)	ybaE ←	putative ABC superfamily transporter periplasmic‑binding protein
RA	463,179	C→A	100%	I104I (ATC→ATA)	cof →	thiamine pyrimidine pyrophosphate hydrolase; HMP‑PP phosphatase
RA	469,232	G→T	25.3%	E271* (GAA→TAA)	amtB →	ammonium transporter
RA	469,775	C→A	29.0%	V281V (GTG→GTT)	tesB ←	acyl‑CoA thioesterase 2
RA	474,138	G→T	100%	intergenic (‑65/+99)	ylaB ← / ← ylaC	putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase/DUF1449 family inner membrane protein
RA	475,805	C→A	100%	A120A (GCG→GCT)	tomB ←	Hha toxicity attenuator; conjugation‑related protein
RA	477,267	G→T	100%	Q865K (CAG→AAG)	acrB ←	multidrug efflux system protein
RA	479,244	C→A	100%	A206S (GCC→TCC)	acrB ←	multidrug efflux system protein
RA	480,820	C→T	100%	D86N (GAC→AAC)	acrA ←	multidrug efflux system
RA	481,667	G→A	100%	A151T (GCG→ACG)	acrR →	transcriptional repressor
RA	482,757	G→T	100%	A256S (GCG→TCG)	mscK →	mechanosensitive channel protein, intermediate conductance, K+ regulated
RA	483,159	G→T	7.1%	D390Y (GAT→TAT)	mscK →	mechanosensitive channel protein, intermediate conductance, K+ regulated
RA	486,494	C→A	100%	R53S (CGC→AGC)	ybaN →	DUF454 family inner membrane protein
RA	490,022	C→A	9.9%	I54I (ATC→ATA)	recR →	gap repair protein
RA	490,089	C→A	8.8%	R77S (CGT→AGT)	recR →	gap repair protein
RA	495,020	T→A	100%	E137V (GAA→GTA)	aes ←	acetyl esterase
RA	496,210	G→T	26.9%	M210I (ATG→ATT)	gsk →	inosine/guanosine kinase
RA	500,234	C→A	64.5%	intergenic (‑82/‑136)	fsr ← / → ushA	putative fosmidomycin efflux system protein/bifunctional UDP‑sugar hydrolase/5'‑nucleotidase
RA	503,475	C→A	9.9%	W21L (TGG→TTG)	ybaP ←	TraB family protein
RA	503,944	G→T	100%	E91* (GAA→TAA)	ybaQ →	putative DNA‑binding transcriptional regulator
RA	509,737	G→A	100%	E97K (GAG→AAG)	cueR →	copper‑responsive regulon transcriptional regulator
RA	517,392	G→T	100%	A507A (GCG→GCT)	ybbP →	putative ABC transporter permease
RA	517,551	G→T	24.0%	P560P (CCG→CCT)	ybbP →	putative ABC transporter permease
RA	518,243	G→T	12.4%	R791L (CGA→CTA)	ybbP →	putative ABC transporter permease
RA	518,654	G→T	8.2%	intergenic (+368/‑63)	ybbP → / → rhsD	putative ABC transporter permease/Rhs family putative polymorphic toxin
RA	518,820	C→A	100%	A35E (GCG→GAG)	rhsD →	Rhs family putative polymorphic toxin
RA	524,334:1	+T	100%	pseudogene (239/491 nt)	ybbD →	pseudogene
RA	524,496	T→G	100%	pseudogene (401/491 nt)	ybbD →	pseudogene
RA	524,983	G→T	23.0%	pseudogene (28/93 nt)	ylbI →	pseudogene, Rhs family protein
RA	525,079	A→T	27.5%	pseudogene (38/66 nt)	ylbG ←	pseudogene, DNA‑binding transcriptional regulator homology
RA	525,268	C→A	13.8%	pseudogene (205/357 nt)	ylbG ←	pseudogene, DNA‑binding transcriptional regulator homology
RA	529,211	A→C	8.6%	S249R (AGT→CGT)	allR →	transcriptional repressor of all and gcl operons; glyoxylate‑induced
RA	530,466	C→A	100%	F365L (TTC→TTA)	gcl →	glyoxylate carboligase
RA	535,073	C→A	24.9%	I157I (ATC→ATA)	allB →	allantoinase
RA	542,200	Δ1 bp	100%	coding (65/1668 nt)	fdrA →	putative NAD(P)‑binding acyl‑CoA synthetase
RA	542,948	T→A	11.2%	I271I (ATT→ATA)	fdrA →	putative NAD(P)‑binding acyl‑CoA synthetase
RA	546,491	G→T	100%	V199V (GTG→GTT)	ybcF →	putative carbonate kinase
RA	549,397	G→T	100%	intergenic (‑1/+2)	lpxH ← / ← ppiB	UDP‑2,3‑diacylglucosamine pyrophosphohydrolase/peptidyl‑prolyl cis‑trans isomerase B (rotamase B)
RA	551,499	G→T	100%	R171S (CGC→AGC)	ybcI ←	DUF457 family inner membrane protein
RA	551,602	A→T	65.8%	F136L (TTT→TTA)	ybcI ←	DUF457 family inner membrane protein
RA	555,927	G→T	26.3%	D259Y (GAT→TAT)	sfmD →	putative outer membrane export usher protein
RA	557,592	G→T	100%	D814Y (GAC→TAC)	sfmD →	putative outer membrane export usher protein
RA	559,245	G→T	20.5%	G154C (GGT→TGT)	sfmF →	FimA homolog
RA	571,730	G→T	29.8%	pseudogene (552/1040 nt)	nmpC ←	DLP12 prophage; truncated outer membrane porin (pseudogene);IS, phage, Tn; Phage or Prophage Related; outer membrane porin protein; locus of qsr prophage
RA	572,600	G→A	5.6%	intergenic (‑319/‑254)	nmpC ← / → essD	DLP12 prophage; truncated outer membrane porin (pseudogene);IS, phage, Tn; Phage or Prophage Related; outer membrane porin protein; locus of qsr prophage/DLP12 prophage; putative phage lysis protein
RA	576,192	T→A	10.1%	intergenic (‑291/‑98)	ylcI ← / → nohD	DUF3950 family protein, DLP12 prophage/DLP12 prophage; DNA packaging protein
RA	576,998	G→T	100%	pseudogene (189/309 nt)	aaaD →	pseudogene; DLP12 prophage; tail fiber assembly protein family;Phage or Prophage Related
RA	579,692	G→A	22.6%	D186N (GAT→AAT)	appY →	global transcriptional activator; DLP12 prophage
RA	580,366	G→T	100%	R242S (CGC→AGC)	ompT ←	DLP12 prophage; outer membrane protease VII (outer membrane protein 3b)
RA	581,203	A→T	100%	intergenic (‑114/‑310)	ompT ← / → pauD	DLP12 prophage; outer membrane protease VII (outer membrane protein 3b)/tRNA‑OTHER
RA	581,503	G→T	57.5%	intergenic (‑414/‑10)	ompT ← / → pauD	DLP12 prophage; outer membrane protease VII (outer membrane protein 3b)/tRNA‑OTHER
RA	581,633	G→T	60.1%	L244L (CTC→CTA)	envY ←	porin thermoregulatory transcriptional activator
RA	582,322	C→A	26.2%	E15* (GAA→TAA)	envY ←	porin thermoregulatory transcriptional activator
RA	583,341	T→G	100%	S33R (AGT→CGT)	ybcH ←	PRK09936 family protein
RA	590,565	A→T	5.7%	V112E (GTG→GAG)	cusR ←	response regulator in two‑component regulatory system with CusS
RA	591,864	C→A	100%	A270E (GCG→GAG)	cusC →	copper/silver efflux system, outer membrane component
RA	601,847	A→T	100%	I331I (ATT→ATA)	ybdK ←	weak gamma‑glutamyl:cysteine ligase
RA	607,931	G→A	100%	S7F (TCC→TTC)	fepA ←	iron‑enterobactin outer membrane transporter
RA	608,104	G→T	47.2%	intergenic (‑154/‑89)	fepA ← / → fes	iron‑enterobactin outer membrane transporter/enterobactin/ferric enterobactin esterase
RA	608,575	T→A	24.7%	L128Q (CTG→CAG)	fes →	enterobactin/ferric enterobactin esterase
RA	614,003	T→A	9.1%	I98I (ATT→ATA)	fepE →	regulator of length of O‑antigen component of lipopolysaccharide chains
RA	614,726	G→T	100%	A339A (GCG→GCT)	fepE →	regulator of length of O‑antigen component of lipopolysaccharide chains
RA	619,048	C→A	100%	A307S (GCC→TCC)	fepB ←	iron‑enterobactin transporter subunit
RA	620,891	C→T	7.6%	P184L (CCG→CTG)	entC →	isochorismate synthase 1
RA	624,669	G→T	100%	T221T (ACG→ACT)	entA →	2,3‑dihydro‑2,3‑dihydroxybenzoate dehydrogenase
RA	625,174	G→T	100%	intergenic (+5/‑176)	entH → / → cstA	enterobactin synthesis proofreading thioesterase/carbon starvation protein involved in peptide utilization; APC peptide transporter family protein
RA	625,364	G→T	100%	G5G (GGG→GGT)	cstA →	carbon starvation protein involved in peptide utilization; APC peptide transporter family protein
RA	627,428	C→A	100%	I693I (ATC→ATA)	cstA →	carbon starvation protein involved in peptide utilization; APC peptide transporter family protein
RA	631,020	G→T	30.2%	Q336K (CAG→AAG)	ybdN ←	PAPS reductase‑like domain protein
RA	634,078	T→A	26.2%	intergenic (‑49/‑323)	dsbG ← / → ahpC	thiol:disulfide interchange protein, periplasmic/alkyl hydroperoxide reductase, C22 subunit
RA	634,111	G→T	10.5%	intergenic (‑82/‑290)	dsbG ← / → ahpC	thiol:disulfide interchange protein, periplasmic/alkyl hydroperoxide reductase, C22 subunit
RA	639,231	G→A	100%	L65F (CTT→TTT)	rnk ←	regulator of nucleoside diphosphate kinase
RA	647,234	C→T	100%	E27K (GAA→AAA)	citC ←	[citrate [pro‑3S]‑lyase] ligase
RA	647,422	G→T	100%	intergenic (‑110/‑269)	citC ← / → citA	[citrate [pro‑3S]‑lyase] ligase/sensory histidine kinase in two‑component regulatory system with CitB
RA	647,509	T→C	100%	intergenic (‑197/‑182)	citC ← / → citA	[citrate [pro‑3S]‑lyase] ligase/sensory histidine kinase in two‑component regulatory system with CitB
RA	648,056	C→A	100%	F122L (TTC→TTA)	citA →	sensory histidine kinase in two‑component regulatory system with CitB
RA	652,574	G→T	27.9%	intergenic (+1/‑174)	pagP → / → cspE	phospholipid:lipid A palmitoyltransferase/constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein
RA	652,597	C→T	100%	intergenic (+24/‑151)	pagP → / → cspE	phospholipid:lipid A palmitoyltransferase/constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein
RA	652,865	Δ1 bp	100%	coding (118/210 nt)	cspE →	constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein
RA	658,096	C→A	70.7%	M1M (ATG→ATT) †	ybeD ←	UPF0250 family protein
RA	659,689	G→T	100%	R320S (CGC→AGC)	rlpA ←	septal ring protein, suppressor of prc, minor lipoprotein
RA	662,108	A→T	100%	V522V (GTT→GTA)	mrdA ←	transpeptidase involved in peptidoglycan synthesis (penicillin‑binding protein 2)
RA	662,631	C→A	100%	R348L (CGC→CTC)	mrdA ←	transpeptidase involved in peptidoglycan synthesis (penicillin‑binding protein 2)
RA	667,174	G→T	16.0%	R157S (CGT→AGT)	lptE ←	LPS assembly OM complex LptDE, lipoprotein component
RA	667,348	G→T	100%	Q99K (CAG→AAG)	lptE ←	LPS assembly OM complex LptDE, lipoprotein component
RA	667,899	C→A	100%	D781Y (GAT→TAT)	leuS ←	leucyl‑tRNA synthetase
RA	672,142	T→A	100%	intergenic (‑139/‑25)	ybeQ ← / → ybeR	Sel1 family TPR‑like repeat protein/uncharacterized protein
RA	676,738	C→A	9.3%	F357L (TTC→TTA)	djlC →	J domain‑containing HscC co‑chaperone; Hsc56
RA	680,846	G→T	100%	F180L (TTC→TTA)	gltK ←	glutamate, aspartate ABC transporter permease subunit
RA	681,457	G→T	9.4%	N223K (AAC→AAA)	gltJ ←	glutamate, aspartate ABC transporter permease subunit
RA	693,739	G→T	100%	H299N (CAC→AAC)	asnB ←	asparagine synthetase B
RA	700,407	C→A	66.0%	N336K (AAC→AAA)	nagE →	fused N‑acetyl glucosamine specific PTS enzyme: IIC, IIB, and IIA components
RA	703,476	C→A	5.9%	intergenic (+263/‑314)	glnS → / → chiP	glutamyl‑tRNA synthetase/chitoporin, uptake of chitosugars
RA	705,588	C→A	100%	intergenic (+16/+68)	chiQ → / ← fur	chitosugar‑induced verified lipoprotein/ferric iron uptake regulon transcriptional repressor; autorepressor
RA	706,097	A→C	100%	T2T (ACT→ACG)  *29G (TGA→GGA)	fur ← uof ←	ferric iron uptake regulon transcriptional repressor; autorepressor ryhB‑regulated fur leader peptide
RA	707,103	T→A	6.2%	L84F (TTA→TTT)	ybfE ←	LexA‑regulated protein, CopB family
RA	710,187	A→T	100%	S392C (AGT→TGT)	pgm →	phosphoglucomutase
RA	715,686	A→T	24.7%	R77R (CGT→CGA)	speF ←	ornithine decarboxylase isozyme, inducible
RA	715,924	C→T	33.8%	intergenic (‑8/‑115)	speF ← / → ybfK	ornithine decarboxylase isozyme, inducible/uncharacterized protein
RA	720,816	G→T	28.0%	I559I (ATC→ATA)	kdpB ←	potassium translocating ATPase, subunit B
RA	723,859	G→T	100%	V110V (GTC→GTA)	kdpA ←	potassium translocating ATPase, subunit A
RA	724,813	A→T	100%	intergenic (+17/‑226)	ybfA → / → rhsC	DUF2517 family protein/Rhs family putative polymorphic toxin
RA	726,087	G→T	100%	R350L (CGT→CTT)	rhsC →	Rhs family putative polymorphic toxin
RA	729,456	G→A	100%	R75R (AGG→AGA)	ybfB →	putative membrane protein
RA	730,891	G→T	100%	pseudogene (1303/1521 nt)	rhsO →	pseudogene, Rhs family protein
RA	732,494	G→T	100%	pseudogene (214/1137 nt)	ybfL →	pseudogene, DDE domain transposase family;putative factor; Not classified; putative receptor protein
RA	732,655	G→T	100%	pseudogene (375/1137 nt)	ybfL →	pseudogene, DDE domain transposase family;putative factor; Not classified; putative receptor protein
RA	737,635	G→T	100%	G126G (GGC→GGA)	dtpD ←	dipeptide and tripeptide permease D
RA	741,536	A→T	5.4%	E49V (GAA→GTA)	nei →	endonuclease VIII/ 5‑formyluracil/5‑hydroxymethyluracil DNA glycosylase
RA	743,797	G→T	100%	R214R (CGC→CGA)	ybgO ←	putative fimbrial protein
RA	745,893	G→A	25.7%	S578L (TCG→TTG)	ybgQ ←	putative outer membrane protein
RA	746,916	A→T	24.2%	F237Y (TTC→TAC)	ybgQ ←	putative outer membrane protein
RA	747,068	A→T	68.7%	I186I (ATT→ATA)	ybgQ ←	putative outer membrane protein
RA	747,318	T→A	5.7%	Q103L (CAG→CTG)	ybgQ ←	putative outer membrane protein
RA	747,973	C→A	100%	P93P (CCG→CCT)	ybgD ←	putative fimbrial‑like adhesin protein
RA	748,707	A→T	100%	I406I (ATT→ATA)	gltA ←	citrate synthase
RA	753,549	G→T	100%	Q135H (CAG→CAT)	sdhB →	succinate dehydrogenase, FeS subunit
RA	754,572	G→T	100%	E137D (GAG→GAT)	sucA →	2‑oxoglutarate decarboxylase, thiamine triphosphate‑binding
RA	759,000	C→A	100%	F177L (TTC→TTA)	sucC →	succinyl‑CoA synthetase, beta subunit
RA	761,253	C→A	58.6%	D27Y (GAT→TAT)	mngR ←	Transcriptional repressor for the mannosyl‑D‑glycerate catabolic operon
RA	767,399	A→T	100%	E162D (GAA→GAT)	cydA →	cytochrome d terminal oxidase, subunit I
RA	769,423	C→T	27.1%	A309V (GCA→GTA)	cydB →	cytochrome d terminal oxidase, subunit II
RA	784,094	G→T	100%	A67E (GCG→GAG)	galM ←	aldose 1‑epimerase; type‑1 mutarotase
RA	788,902	G→T	100%	R115S (CGT→AGT)	modF ←	fused molybdate transporter subunits of ABC superfamily: ATP‑binding components
RA	793,765	G→T	5.0%	I41I (ATC→ATA)	ybhA ←	pyridoxal phosphate (PLP) phosphatase
RA	800,488	G→T	100%	V510V (GTG→GTT)	ybhJ →	putative hydratase
RA	800,779	G→T	100%	E607D (GAG→GAT)	ybhJ →	putative hydratase
RA	805,678	G→T	70.0%	T293T (ACG→ACT)	bioB →	biotin synthase
RA	809,212	G→T	100%	M77I (ATG→ATT)	uvrB →	excinulease of nucleotide excision repair, DNA damage recognition component
RA	811,634	A→T	9.3%	L157* (TTA→TAA)	ybhK ←	putative NAD(P)‑binding transferase
RA	816,302	G→T	100%	R18S (AGG→AGT)	ybhM →	UPF0005 family inner membrane protein
RA	819,200	G→T	15.4%	H252N (CAT→AAT)	ybhP ←	endo/exonuclease/phosphatase family protein
RA	820,503	C→A	100%	T354T (ACG→ACT)	ybhR ←	inner membrane putative ABC superfamily transporter permease
RA	823,968	G→T	7.6%	P157Q (CCG→CAG)	ybhF ←	putative transporter subunit of ABC superfamily: ATP‑binding component
RA	828,374	G→T	100%	V11V (GTC→GTA)	ybiA ←	DUF1768 family protein
RA	829,009	G→T	100%	D162Y (GAT→TAT)	dinG →	ATP‑dependent DNA helicase
RA	832,445	G→T	100%	P213P (CCG→CCT)	ybiC →	putative dehydrogenase
RA	837,132	C→T	100%	intergenic (‑145/+120)	fiu ← / ← mcbA	catecholate siderophore receptor Fiu/colanic acid mucoidy stimulation protein
RA	837,716	G→T	100%	intergenic (‑204/‑72)	mcbA ← / → rlmF	colanic acid mucoidy stimulation protein/23S rRNA m(6)A1618 methyltransferase, SAM‑dependent
RA	842,041	C→A	100%	E179* (GAA→TAA)	glnP ←	glutamine transporter subunit
RA	843,299	C→A	100%	W54C (TGG→TGT)	glnH ←	glutamine transporter subunit
RA	847,118	G→T	15.8%	I312I (ATC→ATA)	ybiP ←	putative EptAB family phosphoethanolamine transferase, inner membrane protein
RA	850,161	G→T	100%	P353P (CCG→CCT)	ybiR →	putative transporter
RA	861,926	C→A	10.2%	intergenic (‑106/‑98)	moeA ← / → iaaA	molybdopterin molybdenumtransferase; molybdopterin biosynthesis protein/Isoaspartyl peptidase
RA	868,500	A→T	100%	S22S (TCA→TCT)	yliE →	putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA	872,975	C→A	21.3%	E173* (GAA→TAA)	rimO ←	ribosomal protein S12 methylthiotransferase; radical SAM superfamily
RA	875,468	C→A	27.1%	D157Y (GAC→TAC)	gstB ←	glutathione S‑transferase
RA	876,395	G→T	100%	M71I (ATG→ATT)	dacC →	D‑alanyl‑D‑alanine carboxypeptidase (penicillin‑binding protein 6a)
RA	876,447	G→A	100%	D89N (GAT→AAT)	dacC →	D‑alanyl‑D‑alanine carboxypeptidase (penicillin‑binding protein 6a)
RA	879,085	G→T	100%	intergenic (‑241/‑44)	ybjG ← / → mdfA	undecaprenyl pyrophosphate phosphatase/multidrug efflux system protein
RA	879,118	G→A	6.9%	intergenic (‑274/‑11)	ybjG ← / → mdfA	undecaprenyl pyrophosphate phosphatase/multidrug efflux system protein
RA	882,672	G→T	100%	L42I (CTC→ATC)	ybjJ ←	putative transporter
RA	888,964	C→T	100%	intergenic (+75/‑276)	ybjN → / → potF	negative regulator of motility; multicopy suppressor of coaA(Ts)/putrescine transporter subunit: periplasmic‑binding component of ABC superfamily
RA	892,358	G→T	100%	V257L (GTG→TTG)	potH →	putrescine transporter subunit: membrane component of ABC superfamily
RA	896,104	G→T	8.7%	intergenic (‑73/+218)	artJ ← / ← artM	arginine binding protein, periplasmic/arginine transporter subunit
RA	899,388	T→G	30.2%	intergenic (‑198/+20)	artP ← / ← ybjP	arginine transporter subunit/lipoprotein
RA	907,893	C→A	26.4%	D460Y (GAT→TAT)	hcp ←	hybrid‑cluster [4Fe‑2S‑2O] protein in anaerobic terminal reductases
RA	925,160	G→T	100%	S420* (TCA→TAA)	cydD ←	fused glutathione, cysteine exporter subunits of ABC superfamily: membrane component/ATP‑binding component
RA	929,657	T→C	60.0%	A326A (GCT→GCC)	ftsK →	DNA translocase at septal ring sorting daughter chromsomes
RA	942,724	A→T	29.0%	N14Y (AAC→TAC)	ycaM →	putative transporter
RA	943,573	G→T	100%	A297S (GCC→TCC)	ycaM →	putative transporter
RA	955,568	A→T	100%	intergenic (+17/‑152)	aroA → / → ycaL	5‑enolpyruvylshikimate‑3‑phosphate synthetase/putative peptidase‑related chaperone
RA	968,415	G→T	100%	S148* (TCG→TAG)	ycbC ←	DUF218 superfamily protein
RA	982,574	C→A	23.6%	intergenic (‑136/+467)	ompF ← / ← asnS	outer membrane porin 1a (Ia;b;F)/asparaginyl tRNA synthetase
RA	992,767	C→A	100%	D68Y (GAT→TAT)	ssuE ←	NAD(P)H‑dependent FMN reductase
RA	994,328	G→T	100%	G128V (GGA→GTA)	elfD →	putative periplasmic pilin chaperone
RA	997,673	A→T	100%	T137T (ACA→ACT)	elfG →	putative fimbrial‑like adhesin protein
RA	997,965	G→T	100%	D235Y (GAT→TAT)	elfG →	putative fimbrial‑like adhesin protein
RA	1,000,841	G→T	100%	A206A (GCG→GCT)	pyrD →	dihydro‑orotate oxidase, FMN‑linked
RA	1,003,597	G→T	100%	D100Y (GAC→TAC)	rlmL →	fused 23S rRNA m(2)G2445 and m(7)G2069 methyltransferase, SAM‑dependent
RA	1,011,929	T→A	100%	intergenic (‑3/+66)	fabA ← / ← ycbZ	beta‑hydroxydecanoyl thioester dehydrase/putative peptidase
RA	1,024,003	C→A	15.7%	D59Y (GAT→TAT)	hspQ ←	heat shock protein involved in degradation of mutant DnaA; hemimethylated oriC DNA‑binding protein
RA	1,024,703	G→T	100%	G241G (GGC→GGA)	rlmI ←	23S rRNA m(5)C1962 methyltransferase, SAM‑dependent
RA	1,038,316	G→T	100%	R451S (CGT→AGT)	etk ←	tyrosine‑protein kinase, role in O‑antigen capsule formation
RA	1,048,928	C→A	100%	E903* (GAA→TAA)	torS ←	hybrid sensory histidine kinase in two‑component regulatory system with TorR
RA	1,049,407	G→T	100%	T743K (ACG→AAG)	torS ←	hybrid sensory histidine kinase in two‑component regulatory system with TorR
RA	1,052,229	G→T	13.3%	L171F (TTG→TTT)	torT →	periplasmic sensory protein associated with the TorRS two‑component regulatory system
RA	1,055,132	G→T	100%	E141* (GAA→TAA)	torA →	trimethylamine N‑oxide (TMAO) reductase I, catalytic subunit
RA	1,057,226	G→T	24.3%	E839* (GAA→TAA)	torA →	trimethylamine N‑oxide (TMAO) reductase I, catalytic subunit
RA	1,058,131	G→T	67.3%	H61N (CAT→AAT)	cbpM ←	modulator of CbpA co‑chaperone
RA	1,067,754	T→A	38.9%	H189L (CAC→CTC)	rutB ←	ureidoacrylate amidohydrolase
RA	1,077,911	A→C	100%	K71N (AAA→AAC)	efeO →	inactive ferrous ion transporter EfeUOB
RA	1,083,443	G→T	100%	S624* (TCG→TAG)	pgaB ←	poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine (PGA) N‑deacetylase outer membrane export lipoprotein
RA	1,084,103	A→T	100%	L404* (TTA→TAA)	pgaB ←	poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine (PGA) N‑deacetylase outer membrane export lipoprotein
RA	1,097,943	T→A	66.5%	N19Y (AAT→TAT)	csgE ←	curlin secretion specificity factor
RA	1,101,777	G→T	61.7%	E168* (GAA→TAA)	ymdB →	O‑acetyl‑ADP‑ribose deacetylase; RNase III inhibitor during cold shock; putative cardiolipin synthase C regulatory subunit
RA	1,103,665	G→T	18.6%	R245S (CGT→AGT)	opgC ←	osmoregulated periplasmic glucan succinylation membrane protein
RA	1,103,695	G→T	5.7%	H235N (CAT→AAT)	opgC ←	osmoregulated periplasmic glucan succinylation membrane protein
RA	1,103,899	A→T	20.4%	S167T (TCT→ACT)	opgC ←	osmoregulated periplasmic glucan succinylation membrane protein
RA	1,104,639	C→A	100%	intergenic (‑242/‑152)	opgC ← / → opgG	osmoregulated periplasmic glucan succinylation membrane protein/osmoregulated periplasmic glucan (OPG) biosynthesis periplasmic protein
RA	1,106,503	C→A	17.0%	S62* (TCA→TAA)	opgH →	membrane glycosyltransferase; nutrient‑dependent cell size regulator, FtsZ assembly antagonist
RA	1,113,450	A→T	100%	I161I (ATT→ATA)	yceI ←	secreted protein
RA	1,114,329	C→A	100%	L58F (TTG→TTT)	yceJ ←	putative cytochrome b561
RA	1,116,548	T→A	100%	intergenic (‑137/+150)	bssS ← / ← dinI	biofilm regulator/DNA damage‑inducible protein I
RA	1,116,964	A→G	100%	intergenic (‑21/+53)	dinI ← / ← pyrC	DNA damage‑inducible protein I/dihydro‑orotase
RA	1,118,506	A→T	7.8%	L75Q (CTA→CAA)	yceB ←	lipoprotein, DUF1439 family
RA	1,118,591	C→A	66.2%	G47C (GGT→TGT)	yceB ←	lipoprotein, DUF1439 family
RA	1,122,429	G→T	12.6%	S56S (TCG→TCT)	yceM →	putative oxidoreductase
RA	1,122,994	C→A	100%	R245S (CGC→AGC)	yceM →	putative oxidoreductase
RA	1,128,764	C→A	28.8%	I245I (ATC→ATA)	flgE →	flagellar hook protein
RA	1,129,972	G→T	27.4%	D239Y (GAT→TAT)	flgF →	flagellar component of cell‑proximal portion of basal‑body rod
RA	1,131,521	C→A	100%	Q168K (CAG→AAG)	flgH →	flagellar protein of basal‑body outer‑membrane L ring
RA	1,133,311	T→A	26.9%	L162Q (CTG→CAG)	flgJ →	flagellar rod assembly protein and murein hydrolase; flagellum‑specific muramidase
RA	1,137,384	G→T	100%	R814S (CGC→AGC)	rne ←	fused ribonucleaseE: endoribonuclease/RNA‑binding protein/RNA degradosome binding protein
RA	1,139,402	C→A	100%	R141L (CGC→CTC)	rne ←	fused ribonucleaseE: endoribonuclease/RNA‑binding protein/RNA degradosome binding protein
RA	1,140,834	A→T	63.0%	T147S (ACC→TCC)	rluC →	23S rRNA pseudouridine(955,2504,2580) synthase
RA	1,146,692	A→T	100%	T189T (ACA→ACT)	fabG →	3‑oxoacyl‑[acyl‑carrier‑protein] reductase
RA	1,147,364	G→T	57.1%	intergenic (+57/‑31)	acpP → / → fabF	acyl carrier protein (ACP)/3‑oxoacyl‑[acyl‑carrier‑protein] synthase II
RA	1,151,750	G→T	100%	R178L (CGC→CTC)	holB →	DNA polymerase III, delta prime subunit
RA	1,152,278	G→T	100%	E16* (GAA→TAA)	ycfH →	putative DNase
RA	1,153,214	T→C	30.3%	intergenic (+184/‑111)	ycfH → / → ptsG	putative DNase/fused glucose‑specific PTS enzymes: IIB component/IIC component
RA	1,156,310	G→T	100%	S233* (TCA→TAA)	fhuE ←	ferric‑rhodotorulic acid outer membrane transporter
RA	1,163,251	A→T	5.2%	Q66L (CAG→CTG)	ycfJ →	uncharacterized protein
RA	1,169,139	G→T	7.6%	T94T (ACC→ACA)	mfd ←	transcription‑repair coupling factor
RA	1,181,504	G→T	100%	D69Y (GAT→TAT)	pepT →	peptidase T
RA	1,191,280	G→T	30.7%	M234I (ATG→ATT)	icd →	e14 prophage; isocitrate dehydrogenase, specific for NADP+
RA	1,191,676	C→T	100%	H366H (CAC→CAT)	icd →	e14 prophage; isocitrate dehydrogenase, specific for NADP+
RA	1,207,417	C→A	28.7%	G15C (GGT→TGT)	iraM ←	RpoS stabilzer during Mg starvation, anti‑RssB factor
RA	1,207,958	G→T	5.6%	intergenic (‑499/+201)	iraM ← / ← ycgX	RpoS stabilzer during Mg starvation, anti‑RssB factor/DUF1398 family protein
RA	1,211,169	C→A	100%	intergenic (‑238/‑76)	bluF ← / → ycgZ	anti‑repressor for YcgE, blue light‑responsive; FAD‑binding; has c‑di‑GMP phosphodiesterase‑like EAL domain, but does not degrade c‑di‑GMP/RcsB connector protein for regulation of biofilm and acid‑resistance
RA	1,214,055	T→A	27.5%	I424I (ATT→ATA)	ycgG →	putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA	1,218,601	T→A	32.8%	K7* (AAG→TAG)	ymgI ←	uncharacterized protein
RA	1,219,533	A→G	100%	intergenic (+170/+202)	ycgI → / ← minE	pseudogene/cell division topological specificity factor
RA	1,220,996	G→T	100%	R181R (CGG→AGG)	minC ←	cell division inhibitor
RA	1,224,292	G→A	100%	D8N (GAT→AAT)	ycgN →	UPF0153 family cysteine cluster protein
RA	1,226,292	T→A	100%	C24S (TGT→AGT)	umuD →	DNA polymerase V, subunit D
RA	1,228,591	G→T	100%	intergenic (‑105/+41)	dsbB ← / ← nhaB	oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I/sodium:proton antiporter
RA	1,241,397	T→A	24.6%	H479L (CAC→CTC)	treA ←	periplasmic trehalase
RA	1,245,611	G→T	60.5%	F228L (TTC→TTA)	dhaK ←	dihydroxyacetone kinase, PTS‑dependent, dihydroxyacetone‑binding subunit
RA	1,249,227	G→T	100%	R728S (CGT→AGT)	ycgV ←	putative adhesin
RA	1,249,716	G→T	61.7%	R565S (CGC→AGC)	ycgV ←	putative adhesin
RA	1,255,258	A→T	11.7%	A334A (GCT→GCA)	dauA ←	C4‑dicarboxylic acid transporter
RA	1,257,232	G→T	100%	R34S (CGC→AGC)	prs ←	phosphoribosylpyrophosphate synthase
RA	1,261,810	G→A	100%	A87A (GCG→GCA)	prmC →	N5‑glutamine methyltransferase, modifies release factors RF‑1 and RF‑2
RA	1,264,442	G→T	100%	V274V (GTG→GTT)	kdsA →	3‑deoxy‑D‑manno‑octulosonate 8‑phosphate synthase
RA	1,276,971	T→A	5.1%	L551H (CTC→CAC)	narG →	nitrate reductase 1, alpha subunit
RA	1,277,786	G→A	100%	D823N (GAC→AAC)	narG →	nitrate reductase 1, alpha subunit
RA	1,281,042	C→A	27.1%	R150S (CGT→AGT)	narJ →	molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA	1,281,517	G→T	7.7%	L71L (CTG→CTT)	narI →	nitrate reductase 1, gamma (cytochrome b(NR)) subunit
RA	1,282,421	A→T	16.8%	intergenic (+439/+101)	narI → / ← rttR	nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
RA	1,284,857	G→T	69.6%	D53Y (GAT→TAT)	rssA →	putative patatin‑like family phospholipase
RA	1,288,669	A→T	100%	intergenic (‑291/‑314)	hns ← / → tdk	global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase
RA	1,288,739	C→A	7.3%	intergenic (‑361/‑244)	hns ← / → tdk	global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase
RA	1,289,975	G→T	10.2%	pseudogene (474/567 nt)	insZ ←	pseudogene, transposase homolog
RA	1,290,033	G→T	100%	pseudogene (416/567 nt)	insZ ←	pseudogene, transposase homolog
RA	1,290,222	T→A	5.4%	pseudogene (227/567 nt)	insZ ←	pseudogene, transposase homolog
RA	1,293,952	G→A	19.5%	intergenic (‑375/‑102)	adhE ← / → ychE	fused acetaldehyde‑CoA dehydrogenase/iron‑dependent alcohol dehydrogenase/pyruvate‑formate lyase deactivase/UPF0056 family inner membrane protein
RA	1,295,079	C→T	6.1%	intergenic (+378/‑360)	ychE → / → oppA	UPF0056 family inner membrane protein/oligopeptide transporter subunit
RA	1,296,729	C→A	100%	H431N (CAC→AAC)	oppA →	oligopeptide transporter subunit
RA	1,308,862	A→C	6.6%	S196R (AGC→CGC)	ompW →	outer membrane protein W
RA	1,318,228	C→A	69.3%	S251* (TCA→TAA)	yciV →	PHP domain protein
RA	1,318,829	G→T	61.8%	E159* (GAA→TAA)	yciO →	putative RNA binding protein
RA	1,322,140	T→A	100%	T159S (ACG→TCG)	btuR ←	cob(I)yrinic acid a,c‑diamide adenosyltransferase
RA	1,325,982	G→T	100%	T226T (ACG→ACT)	topA →	DNA topoisomerase I, omega subunit
RA	1,326,726	A→T	27.2%	P474P (CCA→CCT)	topA →	DNA topoisomerase I, omega subunit
RA	1,328,313	C→A	30.1%	R68S (CGT→AGT)	cysB →	N‑acetylserine‑responsive cysteine regulon transcriptional activator; autorepressor
RA	1,330,955	G→T	100%	D290Y (GAT→TAT)	acnA →	aconitate hydratase 1
RA	1,331,654	G→T	31.1%	D523Y (GAT→TAT)	acnA →	aconitate hydratase 1
RA	1,334,046	G→T	6.4%	E154* (GAG→TAG)	pgpB →	phosphatidylglycerophosphatase B
RA	1,334,992	G→T	8.8%	D60Y (GAT→TAT)	yciM →	envelope integrity maintenance protein; EnvC‑interacting protein
RA	1,335,356	A→T	100%	H181L (CAT→CTT)	yciM →	envelope integrity maintenance protein; EnvC‑interacting protein
RA	1,336,599	T→C	9.9%	L141P (CTT→CCT)	pyrF →	orotidine‑5'‑phosphate decarboxylase
RA	1,337,533	G→T	100%	A18E (GCA→GAA)	osmB ←	lipoprotein
RA	1,341,886	T→A	27.1%	A428A (GCA→GCT)	rnb ←	ribonuclease II
RA	1,345,484	A→C	8.0%	intergenic (‑188/+180)	fabI ← / ← ycjD	enoyl‑[acyl‑carrier‑protein] reductase, NADH‑dependent/DUF559 family endonuclease‑related protein
RA	1,348,772	G→T	100%	P2T (CCT→ACT)  A319D (GCC→GAC)	sapC ← sapB ←	antimicrobial peptide transport ABC transporter permease antimicrobial peptide transport ABC transporter permease
RA	1,350,891	G→T	100%	S159R (AGC→AGA)	sapA ←	antimicrobial peptide transport ABC transporter periplasmic binding protein
RA	1,351,022	G→T	100%	R116S (CGT→AGT)	sapA ←	antimicrobial peptide transport ABC transporter periplasmic binding protein
RA	1,358,855	G→T	100%	G123C (GGC→TGC)	puuB →	gamma‑glutamylputrescine oxidoreductase
RA	1,362,065	G→T	5.3%	I35I (ATC→ATA)	pspF ←	psp operon transcriptional activator
RA	1,364,366	G→A	57.4%	intergenic (+106/‑107)	pspE → / → ycjM	thiosulfate:cyanide sulfurtransferase (rhodanese)/alpha amylase catalytic domain family protein
RA	1,365,283	G→T	100%	E271* (GAG→TAG)	ycjM →	alpha amylase catalytic domain family protein
RA	1,367,252	G→T	26.9%	E363* (GAA→TAA)	ycjN →	putative ABC superfamily sugar transporter periplasmic‑binding protein
JC JC	1,376,043	IS5 (–) +4 bp	100%	pseudogene (10‑13/126 nt)	ycjV →	pseudogene; putative ATP‑binding component of a transport system
RA	1,377,394	C→T	100%	A275A (GCG→GCA)	ycjW ←	LacI family putative transcriptional repressor
RA	1,378,237	G→T	26.0%	intergenic (‑19/‑137)	ycjW ← / → ycjX	LacI family putative transcriptional repressor/DUF463 family protein, putative P‑loop NTPase
RA	1,381,373	A→C	20.0%	N133H (AAT→CAT)	tyrR →	aromatic amino acid biosynthesis and transport regulon transcriptional regulator; autorepressor; ATPase; phosphatase
RA	1,385,964	T→G	14.0%	Q49H (CAA→CAC)	ycjY ←	S9 homolog non‑peptidase family protein
RA	1,386,008	G→T	100%	Q35K (CAG→AAG)	ycjY ←	S9 homolog non‑peptidase family protein
RA	1,388,406	G→T	100%	R308L (CGC→CTC)	mppA →	murein tripeptide (L‑ala‑gamma‑D‑glutamyl‑meso‑DAP) transporter subunit
RA	1,389,852	G→T	100%	R110S (CGC→AGC)	ynaI ←	mechanosensitive channel protein, very small conductance
RA	1,394,355	G→T	25.7%	R47S (CGC→AGC)	ogt ←	O‑6‑alkylguanine‑DNA:cysteine‑protein methyltransferase
RA	1,397,366	A→T	29.4%	S49S (TCT→TCA)	abgB ←	p‑aminobenzoyl‑glutamate hydrolase, B subunit
RA	1,401,341	C→A	7.1%	D238Y (GAT→TAT)	ydaM ←	diguanylate cyclase, csgD regulator
RA	1,407,139	A→T	27.8%	C118* (TGT→TGA)	intR ←	Rac prophage; integrase
RA	1,412,385	G→T	100%	N34K (AAC→AAA)	kilR ←	Rac prophage; inhibitor of ftsZ, killing protein
RA	1,421,685	T→A	12.0%	pseudogene (40/210 nt)	lomR →	pseudogene, Rac prophage lom homolog;Phage or Prophage Related; interrupted by IS5 and N‑ter deletion
RA	1,423,872	T→G	7.6%	A189A (GCT→GCG)	stfR →	Rac prophage; putative tail fiber protein
RA	1,424,234	C→A	100%	S310* (TCA→TAA)	stfR →	Rac prophage; putative tail fiber protein
RA	1,428,220	A→G	8.8%	intergenic (‑289/+28)	pinR ← / ← ynaE	Rac prophage; putative site‑specific recombinase/cold shock protein, Rac prophage
JC JC	1,428,894	IS2 (–) +5 bp	100%	intergenic (‑413/+317)	ynaE ← / ← ttcC	cold shock protein, Rac prophage/pseudogene, prophage Rac integration site ttcA duplication;Phage or Prophage Related
RA	1,430,873	G→T	100%	S93* (TCA→TAA)	ompN ←	outer membrane pore protein N, non‑specific
RA	1,437,184	G→T	29.5%	intergenic (‑84/‑124)	ldhA ← / → ydbH	fermentative D‑lactate dehydrogenase, NAD‑dependent/putative membrane‑anchored protein, function unknown
RA	1,439,518	C→A	100%	S737S (TCC→TCA)	ydbH →	putative membrane‑anchored protein, function unknown
RA	1,441,941	G→T	11.7%	E56* (GAA→TAA)	feaB →	phenylacetaldehyde dehydrogenase
RA	1,442,008	G→T	12.9%	R78L (CGA→CTA)	feaB →	phenylacetaldehyde dehydrogenase
RA	1,451,422	A→T	100%	T246S (ACG→TCG)	paaE →	ring 1,2‑phenylacetyl‑CoA epoxidase, NAD(P)H oxidoreductase component
RA	1,454,724	G→T	100%	G472C (GGT→TGT)	paaH →	3‑hydroxyadipyl‑CoA dehydrogenase, NAD+‑dependent
RA	1,457,725	G→T	100%	intergenic (+30/‑71)	paaK → / → paaX	phenylacetyl‑CoA ligase/transcriptional repressor of phenylacetic acid degradation paa operon, phenylacetyl‑CoA inducer
RA	1,460,747	A→T	6.9%	pseudogene (1099/2513 nt)	ydbA →	pseudogene, autotransporter homolog; interrupted by IS2 and IS30
RA	1,461,041	A→T	100%	pseudogene (1393/2513 nt)	ydbA →	pseudogene, autotransporter homolog; interrupted by IS2 and IS30
RA	1,461,872	G→T	60.9%	pseudogene (2224/2513 nt)	ydbA →	pseudogene, autotransporter homolog; interrupted by IS2 and IS30
RA	1,470,453	C→A	26.4%	V351V (GTC→GTA)	ydbD →	PF10971 family putative periplasmic methylglyoxal resistance protein
RA	1,477,565	A→T	68.9%	K83I (AAA→ATA)	hrpA →	putative ATP‑dependent helicase
RA	1,478,971	G→A	100%	E552K (GAG→AAG)	hrpA →	putative ATP‑dependent helicase
RA	1,479,733	G→T	100%	D806Y (GAT→TAT)	hrpA →	putative ATP‑dependent helicase
RA	1,482,005	G→T	100%	D172Y (GAT→TAT)	ydcF →	DUF218 superfamily protein, SAM‑binding
RA	1,483,460	G→T	24.9%	A324A (GCG→GCT)	aldA →	aldehyde dehydrogenase A, NAD‑linked
RA	1,489,422	T→A	7.1%	intergenic (‑94/‑123)	ydcI ← / → ydcJ	putative DNA‑binding transcriptional regulator/putative metalloenzyme
RA	1,502,848	T→A	10.3%	V604E (GTA→GAA)	ydcP →	putative peptidase
RA	1,503,262	G→T	26.4%	L20L (CTC→CTA)	yncJ ←	uncharacterized protein
RA	1,508,681	C→A	100%	F198L (TTC→TTA)	ydcU →	putative spermidine/putrescine transporter subunit
RA	1,510,854	G→T	71.5%	A340A (GCG→GCT)	patD →	gamma‑aminobutyraldehyde dehydrogenase
RA	1,510,923	G→T	24.9%	T363T (ACG→ACT)	patD →	gamma‑aminobutyraldehyde dehydrogenase
RA	1,512,106	G→T	52.5%	E68* (GAA→TAA)	ydcY →	uncharacterized protein
RA	1,514,177	G→T	100%	E298D (GAG→GAT)	curA →	curcumin/dihydrocurcumin reductase, NADPH‑dependent
RA	1,514,858	G→A	100%	E114K (GAA→AAA)	mcbR →	colanic acid and biofilm gene transcriptional regulator, MqsR‑controlled
RA	1,519,349	T→A	100%	K297* (AAA→TAA)	ansP ←	L‑asparagine transporter
RA	1,522,007	C→A	30.9%	intergenic (+598/‑152)	yncH → / → rhsE	IPR020099 family protein/pseudogene, Rhs family protein
RA	1,522,387	C→A	100%	pseudogene (229/2037 nt)	rhsE →	pseudogene, Rhs family protein
RA	1,523,317	G→T	100%	pseudogene (1159/2037 nt)	rhsE →	pseudogene, Rhs family protein
RA	1,523,802	T→G	66.9%	pseudogene (1644/2037 nt)	rhsE →	pseudogene, Rhs family protein
RA	1,526,607	G→A	100%	D179N (GAT→AAT)	ydcC →	H repeat‑associated putative transposase
RA	1,531,029	G→T	100%	R180S (CGC→AGC)	narW ←	nitrate reductase 2 (NRZ), delta subunit (assembly subunit)
RA	1,534,409	G→T	100%	V813V (GTC→GTA)	narZ ←	nitrate reductase 2 (NRZ), alpha subunit
RA	1,537,806	A→T	100%	L171* (TTA→TAA)	narU ←	nitrate/nitrite transporter
RA	1,539,827	C→A	100%	pseudogene (145/951 nt)	yddK ←	pseudogene, leucine‑rich protein; putative glycoportein
RA	1,540,399	A→G	69.6%	intergenic (‑114/+146)	yddL ← / ← yddG	putative lipoprotein;putative membrane; Not classified; putative outer membrane porin protein/aromatic amino acid exporter
RA	1,542,503	G→T	32.5%	T282T (ACG→ACT)	fdnG →	formate dehydrogenase‑N, alpha subunit, nitrate‑inducible
RA	1,544,432	G→T	25.0%	T925T (ACG→ACT)	fdnG →	formate dehydrogenase‑N, alpha subunit, nitrate‑inducible
RA	1,548,144	G→T	100%	intergenic (‑49/+85)	adhP ← / ← maeA	ethanol‑active dehydrogenase/acetaldehyde‑active reductase/malate dehydrogenase, (decarboxylating, NAD‑requiring) (malic enzyme)
RA	1,548,216	A→T	100%	intergenic (‑121/+13)	adhP ← / ← maeA	ethanol‑active dehydrogenase/acetaldehyde‑active reductase/malate dehydrogenase, (decarboxylating, NAD‑requiring) (malic enzyme)
RA	1,551,620	C→A	70.0%	D226Y (GAC→TAC)	ddpF ←	D,D‑dipeptide permease system, ATP‑binding component
RA	1,552,629	C→A	100%	D216Y (GAT→TAT)	ddpD ←	D,D‑dipeptide permease system, ATP‑binding component
RA	1,552,648	C→A	23.7%	A209A (GCG→GCT)	ddpD ←	D,D‑dipeptide permease system, ATP‑binding component
RA	1,557,390	G→T	11.0%	intergenic (‑57/+201)	ddpX ← / ← dosP	D‑ala‑D‑ala dipeptidase, Zn‑dependent/oxygen sensor, c‑di‑GMP phosphodiesterase, heme‑regulated; cold‑ and stationary phase‑induced bioflim regulator
RA	1,558,685	G→T	100%	R436S (CGC→AGC)	dosP ←	oxygen sensor, c‑di‑GMP phosphodiesterase, heme‑regulated; cold‑ and stationary phase‑induced bioflim regulator
RA	1,559,507	T→A	73.9%	N162Y (AAT→TAT)	dosP ←	oxygen sensor, c‑di‑GMP phosphodiesterase, heme‑regulated; cold‑ and stationary phase‑induced bioflim regulator
RA	1,563,276	G→T	100%	H491N (CAC→AAC)	gadC ←	glutamate:gamma‑aminobutyric acid antiporter
RA	1,565,497	G→A	100%	S269L (TCG→TTG)	gadB ←	glutamate decarboxylase B, PLP‑dependent
RA	1,569,502	T→G	100%	intergenic (‑43/+2)	pqqL ← / ← yddB	putative periplasmic M16 family zinc metalloendopeptidase/putative TonB‑dependent outer membrane receptor
RA	1,570,428	G→T	100%	I483I (ATC→ATA)	yddB ←	putative TonB‑dependent outer membrane receptor
RA	1,570,472	C→A	5.8%	G469C (GGC→TGC)	yddB ←	putative TonB‑dependent outer membrane receptor
RA	1,570,826	C→A	100%	D351Y (GAC→TAC)	yddB ←	putative TonB‑dependent outer membrane receptor
RA	1,571,658	C→A	25.8%	A73A (GCG→GCT)	yddB ←	putative TonB‑dependent outer membrane receptor
RA	1,572,026	A→T	30.5%	L525* (TTA→TAA)	yddA ←	putative multidrug transporter subunit of ABC superfamily, membrane component/ATP‑binding component
RA	1,574,523	T→A	100%	L175F (TTA→TTT)	ydeM ←	putative YdeN‑specific sulfatase‑maturating enzyme
RA	1,575,339	G→T	100%	F481L (TTC→TTA)	ydeN ←	putative Ser‑type periplasmic non‑aryl sulfatase
RA	1,576,325	T→A	100%	N153Y (AAT→TAT)	ydeN ←	putative Ser‑type periplasmic non‑aryl sulfatase
RA	1,576,932	T→C	8.9%	intergenic (‑151/+251)	ydeN ← / ← ydeO	putative Ser‑type periplasmic non‑aryl sulfatase/UV‑inducible global regulator, EvgA‑, GadE‑dependent
RA	1,580,852	C→A	100%	intergenic (‑109/+225)	ydeP ← / ← ydeQ	putative oxidoreductase/putative fimbrial‑like adhesin protein
RA	1,586,743	A→T	8.7%	intergenic (‑44/+179)	hipB ← / ← yneO	antitoxin of HipAB toxin‑antitoxin system/pseudogene, AidA homolog
RA	1,586,871	G→T	100%	intergenic (‑172/+51)	hipB ← / ← yneO	antitoxin of HipAB toxin‑antitoxin system/pseudogene, AidA homolog
RA	1,586,960	C→A	15.2%	pseudogene (5285/5323 nt)	yneO ←	pseudogene, AidA homolog
RA	1,590,878	A→T	100%	pseudogene (1367/5323 nt)	yneO ←	pseudogene, AidA homolog
RA	1,601,871	C→A	31.5%	P90Q (CCG→CAG)	tam →	trans‑aconitate methyltransferase
RA	1,602,054	A→T	17.3%	Y151F (TAC→TTC)	tam →	trans‑aconitate methyltransferase
RA	1,603,440	G→A	100%	intergenic (‑161/+46)	yneE ← / ← uxaB	bestrophin family putative inner membrane protein/altronate oxidoreductase, NAD‑dependent
RA	1,606,775	T→A	9.2%	Q245L (CAG→CTG)	glsB ←	glutaminase 2
RA	1,613,895	T→A	25.4%	L22Q (CTG→CAG)	marA →	multiple antibiotic resistance transcriptional regulator
RA	1,614,089	G→T	100%	E87* (GAG→TAG)	marA →	multiple antibiotic resistance transcriptional regulator
RA	1,614,837	G→T	74.6%	I186I (ATC→ATA)	eamA ←	cysteine and O‑acetyl‑L‑serine efflux system
RA	1,615,694	C→A	14.6%	R36S (CGC→AGC)	ydeE →	putative transporter
RA	1,620,227	C→A	7.8%	E471* (GAA→TAA)	dcp ←	dipeptidyl carboxypeptidase II
RA	1,620,961	T→G	100%	Q226P (CAA→CCA)	dcp ←	dipeptidyl carboxypeptidase II
RA	1,621,733	T→A	26.0%	intergenic (‑96/‑41)	dcp ← / → ydfG	dipeptidyl carboxypeptidase II/NADP‑dependent 3‑hydroxy acid dehydrogenase; malonic semialdehyde reductase
RA	1,628,207	G→A	100%	G110E (GGA→GAA)	pinQ →	Qin prophage; putative site‑specific recombinase
RA	1,631,894	C→T	11.8%	S49N (AGC→AAC)	gnsB ←	Qin prophage; multicopy suppressor of secG(Cs) and fabA6(Ts)
RA	1,637,458	G→T	11.7%	S14Y (TCT→TAT)	quuQ ←	Qin prophage; putative antitermination protein Q
RA	1,641,167	A→T	62.5%	intergenic (+173/+264)	flxA → / ← intK	Qin prophage; uncharacterized protein/pseudogene, integrase fragment, Qin prophage;Phage or Prophage Related
RA	1,642,051	T→G	29.6%	A19A (GCA→GCC)	dicC ←	Qin prophage; DNA‑binding transcriptional regulator for DicB
RA	1,642,135	C→T	100%	intergenic (‑28/‑56)	dicC ← / → dicA	Qin prophage; DNA‑binding transcriptional regulator for DicB/Qin prophage; putative regulator for DicB
RA	1,642,639	G→T	28.8%	intergenic (+41/‑126)	dicA → / → ydfA	Qin prophage; putative regulator for DicB/Qin prophage; uncharacterized protein
RA	1,643,955	C→A	74.0%	A30A (GCC→GCA)	dicB →	Qin prophage; cell division inhibition protein
RA	1,646,372	C→A	100%	pseudogene (565/1158 nt)	intQ →	pseudogene, Qin prophage; phage integrase family;Phage or Prophage Related
RA	1,649,465	T→C	5.3%	intergenic (‑67/+139)	rspA ← / ← ynfA	bifunctional D‑altronate/D‑mannonate dehydratase/UPF0060 family inner membrane protein
RA	1,655,286	A→T	13.8%	V158V (GTA→GTT)	ynfF →	S‑ and N‑oxide reductase, A subunit, periplasmic
RA	1,659,446	T→C	8.9%	intergenic (+69/‑126)	dmsD → / → clcB	twin‑argninine leader‑binding protein for DmsA and TorA/H(+)/Cl(‑) exchange transporter
RA	1,659,882	C→A	63.1%	S104* (TCG→TAG)	clcB →	H(+)/Cl(‑) exchange transporter
RA	1,661,763	C→A	100%	P353P (CCG→CCT)	mlc ←	glucosamine anaerobic growth regulon transcriptional repressor; autorepressor
RA	1,666,805	A→C	64.2%	S197R (AGT→CGT)	ydgD →	putative peptidase
RA	1,669,413	G→T	11.2%	P402Q (CCG→CAG)	pntB ←	pyridine nucleotide transhydrogenase, beta subunit
RA	1,669,592	G→T	100%	F342L (TTC→TTA)	pntB ←	pyridine nucleotide transhydrogenase, beta subunit
RA	1,672,692	T→A	7.8%	L3L (CTT→CTA)	ydgH →	DUF1471 family periplasmic protein
RA	1,672,843	A→T	7.4%	K54* (AAA→TAA)	ydgH →	DUF1471 family periplasmic protein
RA	1,675,261	T→A	6.8%	L10* (TTA→TAA)	folM →	dihydromonapterin reductase, NADPH‑dependent; dihydrofolate reductase isozyme
RA	1,680,642	C→A	100%	E68D (GAG→GAT)	fumC ←	fumarate hydratase (fumarase C),aerobic Class II
RA	1,683,582	C→A	27.5%	F250L (TTC→TTA)	manA →	mannose‑6‑phosphate isomerase
RA	1,684,105	C→A	100%	intergenic (+97/‑4)	manA → / → ydgA	mannose‑6‑phosphate isomerase/DUF945 family protein
RA	1,687,003	T→A	26.2%	R36* (AGA→TGA)	uidC ←	putative outer membrane porin for beta‑glucuronides porin protein
RA	1,688,819	C→A	28.4%	E504* (GAA→TAA)	uidA ←	beta‑D‑glucuronidase
RA	1,689,180	T→G	100%	E383D (GAA→GAC)	uidA ←	beta‑D‑glucuronidase
RA	1,692,573	C→A	100%	D289Y (GAT→TAT)	malI ←	transcriptional repressor of Mal regulon
RA	1,696,612	A→T	100%	E41D (GAA→GAT)	add →	adenosine deaminase
RA	1,699,862	T→A	100%	L119* (TTG→TAG)	ydgK →	DUF2569 family inner membrane protein
RA	1,700,008	T→A	25.4%	intergenic (+61/‑16)	ydgK → / → rsxA	DUF2569 family inner membrane protein/SoxR iron‑sulfur cluster reduction factor component; inner membrane protein of electron transport complex
RA	1,702,966	T→A	8.3%	R597R (CGT→CGA)	rsxC →	SoxR iron‑sulfur cluster reduction factor component; putative membrane‑associated NADH oxidoreductase of electron transport complex
RA	1,703,062	T→A	10.0%	R629R (CGT→CGA)	rsxC →	SoxR iron‑sulfur cluster reduction factor component; putative membrane‑associated NADH oxidoreductase of electron transport complex
RA	1,703,071	A→T	11.2%	A632A (GCA→GCT)	rsxC →	SoxR iron‑sulfur cluster reduction factor component; putative membrane‑associated NADH oxidoreductase of electron transport complex
RA	1,703,101	C→G	11.7%	A642A (GCC→GCG)	rsxC →	SoxR iron‑sulfur cluster reduction factor component; putative membrane‑associated NADH oxidoreductase of electron transport complex
RA	1,703,104	G→A	6.3%	E643E (GAG→GAA)	rsxC →	SoxR iron‑sulfur cluster reduction factor component; putative membrane‑associated NADH oxidoreductase of electron transport complex
RA	1,710,635	T→A	11.3%	E282V (GAG→GTG)	tyrS ←	tyrosyl‑tRNA synthetase
RA	1,711,397	C→T	100%	R28Q (CGA→CAA)	tyrS ←	tyrosyl‑tRNA synthetase
RA	1,712,562	C→A	75.9%	D31Y (GAT→TAT)	mliC ←	inhibitor of c‑type lysozyme, membrane‑bound; putative lipoprotein
RA	1,715,383	C→A	28.7%	F34L (TTC→TTA)	ydhI →	DUF1656 family putative inner membrane efflux pump associated protein
RA	1,717,809	G→A	55.1%	V478I (GTC→ATC)	ydhK →	putative efflux protein (PET) component of YdhJK efflux pump
RA	1,718,414	A→T	59.4%	Y167N (TAT→AAT)	sodC ←	superoxide dismutase, Cu, Zn, periplasmic
RA	1,720,180	C→A	11.1%	intergenic (‑3/‑100)	ydhL ← / → nemR	DUF1289 family protein/transcriptional repressor for the nemRA‑gloA operon, quinone‑, glyoxal‑, and HOCl‑activated
RA	1,723,809	G→T	100%	E156* (GAA→TAA)	lhr →	putative ATP‑dependent helicase
RA	1,729,371	T→A	8.7%	V227E (GTG→GAG)	mepH →	murein DD‑endopeptidase, space‑maker hydrolase
RA	1,731,596	C→A	32.2%	intergenic (‑49/+117)	ydhP ← / ← ynhF	putative transporter/stress response membrane
RA	1,733,201	A→C	6.0%	L285L (CTT→CTG)	ydhB ←	LysR family putative transcriptional regulator
RA	1,735,082	G→T	60.0%	V305V (GTG→GTT)	ydhC →	putative arabinose efflux transporter
RA	1,739,015	T→A	60.9%	I434I (ATT→ATA)	mdtK →	multidrug efflux system transporter
RA	1,745,619	C→A	12.3%	V121V (GTG→GTT)	ydhW ←	FNR, Nar, NarP‑regulated protein; putative subunit of YdhYVWXUT oxidoreductase complex
RA	1,754,950	T→A	100%	I367F (ATT→TTT)	sufD ←	component of SufBCD Fe‑S cluster assembly scaffold
RA	1,755,150	A→T	75.5%	L300* (TTG→TAG)	sufD ←	component of SufBCD Fe‑S cluster assembly scaffold
RA	1,760,702	G→T	24.8%	I747I (ATC→ATA)	ydiJ ←	putative FAD‑linked oxidoreductase
RA	1,764,150	G→T	100%	D274Y (GAT→TAT)	ydiK →	UPF0118 family inner membrane protein
RA	1,767,220	T→A	26.1%	F151Y (TTC→TAC)	ydiN →	MFS transporter superfamily protein
RA	1,768,689	C→A	100%	S215* (TCA→TAA)	ydiB →	quinate/shikimate 5‑dehydrogenase, NAD(P)‑binding
RA	1,769,763	T→A	100%	intergenic (+62/‑81)	aroD → / → ydiF	3‑dehydroquinate dehydratase/putative acetyl‑CoA:acetoacetyl‑CoA transferase: alpha subunit/beta subunit
RA	1,770,281	T→A	100%	D146E (GAT→GAA)	ydiF →	putative acetyl‑CoA:acetoacetyl‑CoA transferase: alpha subunit/beta subunit
RA	1,770,878	C→A	12.5%	I345I (ATC→ATA)	ydiF →	putative acetyl‑CoA:acetoacetyl‑CoA transferase: alpha subunit/beta subunit
RA	1,777,451	C→A	100%	A55E (GCG→GAG)	fadK →	short chain acyl‑CoA synthetase, anaerobic
RA	1,781,790	A→T	23.5%	Q30L (CAA→CTA)	ppsR →	bifunctional regulatory protein: PEP synthase kinase and PEP synthase pyrophosphorylase
RA	1,782,065	A→T	58.8%	N122Y (AAT→TAT)	ppsR →	bifunctional regulatory protein: PEP synthase kinase and PEP synthase pyrophosphorylase
RA	1,782,353	C→A	10.4%	R218S (CGC→AGC)	ppsR →	bifunctional regulatory protein: PEP synthase kinase and PEP synthase pyrophosphorylase
RA	1,783,091	G→T	100%	E134* (GAG→TAG)	aroH →	3‑deoxy‑D‑arabino‑heptulosonate‑7‑phosphate synthase, tryptophan repressible
RA	1,784,871	C→A	23.7%	D211Y (GAT→TAT)	ydiU ←	UPF0061 family protein
RA	1,787,242	C→A	18.0%	D192Y (GAT→TAT)	btuD ←	vitamin B12 transporter subunit : ATP‑binding component of ABC superfamily
RA	1,788,346	C→A	29.1%	T7T (ACG→ACT)	btuE ←	glutathione peroxidase
RA	1,791,290	G→T	5.1%	I304I (ATC→ATA)	pheT ←	phenylalanine tRNA synthetase, beta subunit
RA	1,796,101	C→A	100%	D243Y (GAC→TAC)	thrS ←	threonyl‑tRNA synthetase
RA	1,800,129	C→T	100%	W71* (TGG→TAG)	ydiY ←	acid‑inducible putative outer membrane protein
RA	1,802,047	G→A	100%	intergenic (+100/‑6)	ydiZ → / → yniA	uncharacterized protein/fructosamine kinase family protein
RA	1,803,109	C→T	100%	A128T (GCC→ACC)	yniB ←	putative inner membrane protein
RA	1,812,514	C→A	100%	D82Y (GAT→TAT)	chbF ←	phospho‑chitobiase; general 6‑phospho‑beta‑glucosidase activity
RA	1,818,738	C→A	68.8%	D153Y (GAC→TAC)	ves ←	cold‑ and stress‑inducible protein
RA	1,819,265	G→T	5.1%	intergenic (‑71/+132)	ves ← / ← spy	cold‑ and stress‑inducible protein/periplasmic ATP‑independent protein refolding chaperone, stress‑induced
RA	1,819,892	C→A	56.1%	intergenic (‑10/+320)	spy ← / ← astE	periplasmic ATP‑independent protein refolding chaperone, stress‑induced/succinylglutamate desuccinylase
RA	1,820,888	C→A	100%	C98F (TGC→TTC)	astE ←	succinylglutamate desuccinylase
RA	1,821,696	A→T	100%	L274Q (CTG→CAG)	astB ←	succinylarginine dihydrolase
RA	1,823,802	C→A	24.6%	V64F (GTT→TTT)	astD ←	succinylglutamic semialdehyde dehydrogenase
RA	1,825,763	C→A	100%	A159A (GCG→GCT)	astC ←	succinylornithine transaminase, PLP‑dependent
RA	1,829,319	C→A	100%	I85I (ATC→ATA)	ydjZ →	TVP38/TMEM64 family inner membrane protein
RA	1,832,413	C→A	100%	L315L (CTC→CTA)	ynjC →	inner membrane putative ABC superfamily transporter permease
RA	1,833,730	C→A	100%	R3S (CGT→AGT)	ynjE →	molybdopterin synthase sulfurtransferase
RA	1,836,179	G→A	25.4%	Q72* (CAG→TAG)	ynjH ←	DUF1496 family protein
RA	1,836,192	T→A	100%	I67I (ATA→ATT)	ynjH ←	DUF1496 family protein
RA	1,839,854	C→A	66.8%	R455L (CGC→CTC)	topB ←	DNA topoisomerase III
RA	1,842,276	T→A	29.0%	intergenic (‑11/+106)	selD ← / ← ydjA	selenophosphate synthase/putative oxidoreductase
RA	1,849,178	A→T	12.7%	intergenic (‑67/+70)	ydjF ← / ← ydjG	putative DNA‑binding transcriptional regulator/alpha‑Keto reductase, NADH‑dependent; can use methylglyoxal as substrate
RA	1,850,851	G→A	5.9%	T112I (ACA→ATA)	ydjH ←	putative kinase
RA	1,852,274	C→A	100%	D273Y (GAT→TAT)	ydjJ ←	putative Zn‑dependent NAD(P)‑binding oxidoreductase
RA	1,852,913	C→A	71.0%	E60* (GAA→TAA)	ydjJ ←	putative Zn‑dependent NAD(P)‑binding oxidoreductase
RA	1,855,239	A→T	61.9%	N117K (AAT→AAA)	ydjL ←	putative Zn‑dependent NAD(P)‑binding oxidoreductase
RA	1,858,693	T→A	19.9%	L196Q (CTG→CAG)	yeaD →	D‑hexose‑6‑phosphate epimerase‑like protein
RA	1,859,132	A→C	100%	A254A (GCT→GCG)	yeaE ←	aldo‑keto reductase, methylglyoxal to acetol, NADPH‑dependent
RA	1,860,183	G→T	100%	R183S (CGC→AGC)	mipA ←	scaffolding protein for murein synthesizing machinery
RA	1,860,951	A→C	9.0%	intergenic (‑222/‑214)	mipA ← / → yeaG	scaffolding protein for murein synthesizing machinery/protein kinase, endogenous substrate unidentified; autokinase
RA	1,865,000	C→A	100%	P120Q (CCA→CAA)	yeaI →	putative membrane‑anchored diguanylate cyclase
RA	1,865,422	C→A	100%	R261R (CGA→AGA)	yeaI →	putative membrane‑anchored diguanylate cyclase
RA	1,865,836	G→T	31.3%	D399Y (GAT→TAT)	yeaI →	putative membrane‑anchored diguanylate cyclase
RA	1,870,743	C→A	100%	H272N (CAT→AAT)	yeaN →	putative transporter
RA	1,872,054	A→T	100%	E28V (GAG→GTG)	yeaP →	diguanylate cyclase
RA	1,872,520	G→T	100%	P183P (CCG→CCT)	yeaP →	diguanylate cyclase
RA	1,872,783	C→A	23.7%	S271* (TCG→TAG)	yeaP →	diguanylate cyclase
RA	1,874,924	T→A	100%	V31V (GTA→GTT)	leuE ←	leucine efflux protein
RA	1,875,096	G→T	100%	intergenic (‑80/+47)	leuE ← / ← dmlR	leucine efflux protein/transcriptional activator of dmlA
RA	1,881,557	C→A	22.6%	R231L (CGC→CTC)	rnd ←	ribonuclease D
RA	1,881,645	C→A	100%	D202Y (GAT→TAT)	rnd ←	ribonuclease D
RA	1,885,611	G→T	100%	R628S (CGT→AGT)	yoaA ←	putative ATP‑dependent helicase, DinG family
RA	1,886,725	G→T	100%	I256I (ATC→ATA)	yoaA ←	putative ATP‑dependent helicase, DinG family
RA	1,899,504	T→C	13.1%	V149V (GTT→GTC)	yobD →	UPF0266 family inner membrane protein
RA	1,902,080	T→A	8.6%	intergenic (‑232/+438)	yobF ← / ← yebO	DUF2527 family heat‑induced protein/putative inner membrane protein
RA	1,909,342	T→A	100%	E150D (GAA→GAT)	proQ ←	RNA chaperone, putative ProP translation regulator
RA	1,916,375	G→T	20.0%	intergenic (+102/‑3)	yebV → / → yebW	uncharacterized protein/uncharacterized protein
RA	1,922,164	C→A	72.2%	P311P (CCG→CCT)	ptrB ←	protease II
RA	1,925,398	C→A	9.5%	A87A (GCC→GCA)	purT →	phosphoribosylglycinamide formyltransferase 2
RA	1,928,359	A→C	5.8%	F168C (TTT→TGT)	edd ←	6‑phosphogluconate dehydratase
RA	1,932,296	G→T	58.1%	D131Y (GAT→TAT)	pykA →	pyruvate kinase II
RA	1,932,622	C→A	7.1%	I239I (ATC→ATA)	pykA →	pyruvate kinase II
RA	1,932,701	C→A	21.5%	Q266K (CAG→AAG)	pykA →	pyruvate kinase II
RA	1,933,029	A→T	6.7%	H375L (CAC→CTC)	pykA →	pyruvate kinase II
RA	1,940,498	G→T	100%	intergenic (‑61/‑10)	yobI ← / → yebB	uncharacterized protein/DUF830 family protein
RA	1,940,633	C→A	15.5%	I42I (ATC→ATA)	yebB →	DUF830 family protein
RA	1,944,177	C→A	100%	L201L (CTG→CTT)	aspS ←	aspartyl‑tRNA synthetase
RA	1,945,085	C→A	7.5%	intergenic (‑306/‑4)	aspS ← / → yecD	aspartyl‑tRNA synthetase/isochorismatase family protein
RA	1,951,334	C→A	100%	T352T (ACG→ACT)	torY ←	TMAO reductase III (TorYZ), cytochrome c‑type subunit
RA	1,953,876	C→A	100%	P76P (CCG→CCT)	yecM ←	putative metal‑binding enzyme
RA	1,955,401	C→A	59.6%	S361S (TCC→TCA)	argS →	arginyl‑tRNA synthetase
RA	1,959,915	C→A	100%	P178P (CCG→CCT)	flhB ←	flagellin export apparatus, substrate specificity protein
RA	1,962,923	C→A	100%	M233I (ATG→ATT)	cheR ←	chemotaxis regulator, protein‑glutamate methyltransferase
RA	1,963,075	G→T	58.8%	R183R (CGG→AGG)	cheR ←	chemotaxis regulator, protein‑glutamate methyltransferase
RA	1,963,622	A→T	19.7%	intergenic (‑1/+18)	cheR ← / ← tap	chemotaxis regulator, protein‑glutamate methyltransferase/methyl‑accepting protein IV
RA	1,969,291	G→T	100%	I97I (ATC→ATA)	cheA ←	fused chemotactic sensory histidine kinase in two‑component regulatory system with CheB and CheY: sensory histidine kinase/signal sensing protein
RA	1,970,820	G→T	67.8%	R193S (CGT→AGT)	motA ←	proton conductor component of flagella motor
RA	1,984,987	C→A	100%	T38T (ACG→ACT)	yecA ←	UPF0149 family protein
RA	1,986,289	T→A	100%	N4Y (AAT→TAT)	pgsA ←	phosphatidylglycerophosphate synthetase
RA	1,993,530	C→A	100%	E113* (GAG→TAG)	fliY ←	cystine transporter subunit
RA	1,997,314	G→T	100%	intergenic (‑227/‑39)	fliC ← / → fliD	flagellar filament structural protein (flagellin)/flagellar filament capping protein
RA	1,999,632	G→T	100%	intergenic (+73/‑5)	fliT → / → amyA	putative flagellar synthesis and assembly chaperone/cytoplasmic alpha‑amylase
RA	2,002,354	C→A	100%	L199L (CTC→CTA)	yedE →	UPF0394 family sulfur transport domain‑containing inner membrane protein
RA	2,003,722	G→T	7.5%	E141* (GAA→TAA)	yedK →	DUF159 family protein
RA	2,004,533	G→T	100%	T151T (ACG→ACT)	yedL →	putative acyl transferase
RA	2,008,669	C→A	28.1%	T103T (ACC→ACA)	fliG →	flagellar motor switching and energizing component
RA	2,015,913	G→T	7.5%	T188T (ACG→ACT)	fliP →	flagellar biosynthesis protein
RA	2,020,166	C→A	100%	D445Y (GAC→TAC)	yedQ ←	putative membrane‑anchored diguanylate cyclase
RA	2,021,954	C→A	65.9%	E298D (GAG→GAT)	yedI ←	DUF808 family inner membrane protein
RA	2,027,334	G→T	7.7%	intergenic (+114/‑198)	rseX → / → yedS	sRNA antisense regulator of ompA and ompC translation, Hfq‑dependent/pseudogene, outer membrane protein homology; putative outer membrane protein
RA	2,035,090	C→A	100%	Q79K (CAG→AAG)	zinT →	zinc and cadmium binding protein, periplasmic
RA	2,036,102	C→A	12.0%	S85* (TCG→TAG)	yodB →	cytochrome b561 homolog
RA	2,040,890	C→A	25.9%	G824G (GGC→GGA)	yeeJ →	putative adhesin
RA	2,041,346	C→A	100%	I976I (ATC→ATA)	yeeJ →	putative adhesin
RA	2,043,643	T→A	16.9%	L1742Q (CTG→CAG)	yeeJ →	putative adhesin
RA	2,046,600	G→T	100%	pseudogene (210/1053 nt)	yeeL ←	pseudogene, glycosyltransferase homology
RA	2,049,111	C→A	100%	T190T (ACC→ACA)	amn →	AMP nucleosidase
RA	2,064,466	C→A	27.0%	pseudogene (326/552 nt)	yeeP →	pseudogene, CP4‑44 prophage; 50S ribosome‑binding GTPase family;Phage or Prophage Related; putative histone
RA	2,067,908	T→A	65.5%	V963V (GTT→GTA)	flu →	CP4‑44 prophage; antigen 43 (Ag43) phase‑variable biofilm formation autotransporter
RA	2,069,147	G→T	12.5%	P296P (CCG→CCT)	yeeR →	CP4‑44 prophage; putative membrane protein
RA	2,074,680	A→T	100%	W22R (TGG→AGG)	sbmC ←	DNA gyrase inhibitor
RA	2,076,118	C→T	22.6%	intergenic (‑90/‑119)	dacD ← / → sbcB	D‑alanyl‑D‑alanine carboxypeptidase (penicillin‑binding protein 6b)/exodeoxyribonuclease I; exonuclease I
RA	2,077,212	A→T	100%	N326Y (AAT→TAT)	sbcB →	exodeoxyribonuclease I; exonuclease I
JC JC	2,080,274	IS2 (–) +5 bp	100%	coding (266‑270/1359 nt)	plaP ←	putrescine importer, low affinity
RA	2,086,004	C→A	100%	A42A (GCC→GCA)	hisC →	histidinol‑phosphate aminotransferase
RA	2,093,160	A→C	8.6%	intergenic (‑66/+183)	ugd ← / ← gnd	UDP‑glucose 6‑dehydrogenase/6‑phosphogluconate dehydrogenase, decarboxylating
RA	2,093,612	C→A	67.1%	E380* (GAA→TAA)	gnd ←	6‑phosphogluconate dehydrogenase, decarboxylating
RA	2,093,906	C→A	22.7%	E282* (GAG→TAG)	gnd ←	6‑phosphogluconate dehydrogenase, decarboxylating
RA	2,098,995	C→A	100%	G182* (GGA→TGA)	wbbI ←	d‑Galf:alpha‑d‑Glc beta‑1,6‑galactofuranosyltransferase
RA	2,099,341	T→G	28.2%	L66F (TTA→TTC)	wbbI ←	d‑Galf:alpha‑d‑Glc beta‑1,6‑galactofuranosyltransferase
RA	2,101,912	T→G	100%	E385A (GAG→GCG)	wzxB ←	putative polisoprenol‑linked O‑antigen transporter
RA	2,102,391	A→C	28.0%	S225S (TCT→TCG)	wzxB ←	putative polisoprenol‑linked O‑antigen transporter
RA	2,107,728	C→A	29.1%	E27D (GAG→GAT)	wcaN ←	putative regulatory subunit for GalU
RA	2,108,219:1	+A	100%	coding (1159/1395 nt)	wcaM ←	colanic acid biosynthesis protein
RA	2,109,267	A→T	8.1%	I37I (ATT→ATA)	wcaM ←	colanic acid biosynthesis protein
RA	2,109,283	C→G	6.7%	R32P (CGA→CCA)	wcaM ←	colanic acid biosynthesis protein
RA	2,110,346	G→A	100%	T88I (ACC→ATC)	wcaL ←	putative glycosyl transferase
RA	2,114,911	A→T	100%	L42Q (CTG→CAG)	wcaJ ←	colanic biosynthesis UDP‑glucose lipid carrier transferase
RA	2,118,194	A→T	7.6%	L345Q (CTG→CAG)	wcaI ←	putative glycosyl transferase
RA	2,122,013	G→T	100%	T119T (ACC→ACA)	wcaF ←	putative acyl transferase
RA	2,122,266	G→T	100%	S35* (TCG→TAG)	wcaF ←	putative acyl transferase
RA	2,122,453	C→T	100%	A227T (GCT→ACT)	wcaE ←	putative glycosyl transferase
RA	2,122,653	C→T	100%	W160* (TGG→TAG)	wcaE ←	putative glycosyl transferase
RA	2,124,268	A→T	6.2%	F31Y (TTC→TAC)	wcaD ←	putative colanic acid polymerase
RA	2,126,771	C→A	13.7%	E36D (GAG→GAT)	wcaA ←	putative glycosyl transferase
RA	2,128,128	T→A	100%	K336* (AAA→TAA)	wzc ←	colanic acid production tyrosine‑protein kinase; autokinase; Ugd phosphorylase
RA	2,138,039	C→A	74.1%	I431I (ATC→ATA)	yegE →	putative diguanylate cyclase
RA	2,138,702	T→A	25.7%	S652R (AGT→AGA)	yegE →	putative diguanylate cyclase
RA	2,139,910	G→T	100%	R1055L (CGA→CTA)	yegE →	putative diguanylate cyclase
RA	2,141,613	G→T	70.2%	V153V (GTG→GTT)	yegD →	Hsp70 chaperone family protein
RA	2,144,474	C→A	100%	intergenic (‑8/‑192)	yegI ← / → yegJ	protein kinase‑related putative non‑specific DNA‑binding protein/uncharacterized protein
RA	2,149,603	A→T	100%	E287V (GAA→GTA)	mdtB →	multidrug efflux system, subunit B
RA	2,152,444	C→A	100%	A193E (GCG→GAG)	mdtC →	multidrug efflux system, subunit C
RA	2,167,068	C→A	25.8%	V230V (GTG→GTT)	gatC ←	galactitol PTS permease ‑ GatC subunit
RA	2,168,795	C→A	100%	D336Y (GAT→TAT)	gatZ ←	D‑tagatose 1,6‑bisphosphate aldolase 2, subunit
RA	2,169,260	C→A	9.2%	A181S (GCC→TCC)	gatZ ←	D‑tagatose 1,6‑bisphosphate aldolase 2, subunit
RA	2,170,534	C→A	29.1%	T50T (ACG→ACT)	gatY ←	D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit
RA	2,170,708	G→T	7.5%	intergenic (‑25/+283)	gatY ← / ← fbaB	D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I
RA	2,170,713	C→A	20.1%	intergenic (‑30/+278)	gatY ← / ← fbaB	D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I
RA	2,170,724	G→T	23.4%	intergenic (‑41/+267)	gatY ← / ← fbaB	D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I
RA	2,170,757	T→A	5.0%	intergenic (‑74/+234)	gatY ← / ← fbaB	D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I
RA	2,170,758	C→A	7.2%	intergenic (‑75/+233)	gatY ← / ← fbaB	D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I
RA	2,175,947	A→T	6.1%	V105E (GTG→GAG)	yegW ←	putative DNA‑binding transcriptional regulator
RA	2,178,914	G→T	9.7%	intergenic (‑134/+89)	thiM ← / ← rcnR	hydoxyethylthiazole kinase/transcriptional repressor of rcnA
RA	2,179,205	G→T	100%	A24E (GCG→GAG)	rcnR ←	transcriptional repressor of rcnA
RA	2,179,279	A→T	29.9%	intergenic (‑4/‑117)	rcnR ← / → rcnA	transcriptional repressor of rcnA/membrane protein conferring nickel and cobalt resistance
RA	2,181,645	A→G	100%	N83N (AAT→AAC)	yehA ←	putative fimbrial‑like adhesin protein
RA	2,183,642	C→A	27.8%	D250Y (GAT→TAT)	yehB ←	putative outer membrane protein
RA	2,194,695	T→A	100%	L313Q (CTA→CAA)	yehI →	DUF4132 domain‑containing protein
RA	2,195,449	A→T	100%	E564D (GAA→GAT)	yehI →	DUF4132 domain‑containing protein
RA	2,198,343	C→A	100%	S90Y (TCT→TAT)	yehL →	putative ABC superfamily transporter ATP‑binding subunit
RA	2,201,014	C→A	22.2%	A614E (GCG→GAG)	yehM →	uncharacterized protein
RA	2,209,162	C→A	100%	I9I (ATC→ATA)	yohO →	putative membrane protein
RA	2,211,664	C→A	28.7%	D125Y (GAT→TAT)	yehY ←	inner membrane putative ABC superfamily transporter permease
RA	2,216,296	C→A	100%	I211I (ATC→ATA)	dld →	D‑lactate dehydrogenase, FAD‑binding, NADH independent
RA	2,218,022	C→A	100%	E110* (GAA→TAA)	pbpG ←	D‑alanyl‑D‑alanine endopeptidase
RA	2,222,684	G→C	6.0%	intergenic (+140/+233)	yohP → / ← dusC	uncharacterized protein/tRNA‑dihydrouridine synthase C
RA	2,222,970	T→A	100%	N299Y (AAT→TAT)	dusC ←	tRNA‑dihydrouridine synthase C
RA	2,223,247	C→T	100%	W206* (TGG→TGA)	dusC ←	tRNA‑dihydrouridine synthase C
RA	2,225,190	C→T	100%	G231G (GGC→GGT)	yohK →	LrgB family inner membrane protein
RA	2,226,594	G→T	25.8%	G80C (GGT→TGT)	sanA →	vancomycin high temperature exclusion protein, DUF218 superfamily protein
RA	2,234,532	C→A	100%	D206Y (GAT→TAT)	galS ←	galactose‑ and fucose‑inducible galactose regulon transcriptional isorepressor; mgl operon transcriptional repressor; autorepressor
RA	2,237,098	G→T	100%	H12N (CAT→AAT)	folE ←	GTP cyclohydrolase I
RA	2,240,676	C→A	19.2%	D446Y (GAC→TAC)	lysP ←	lysine transporter
RA	2,241,222	T→G	100%	I264L (ATT→CTT)	lysP ←	lysine transporter
RA	2,243,991	T→A	67.3%	W266R (TGG→AGG)	yeiH →	UPF0324 family inner membrane protein
RA	2,245,476	G→A	59.2%	A100T (GCC→ACC)	yeiI →	putative kinase
RA	2,247,093	A→T	6.1%	C178S (TGT→AGT)	nupX ←	nucleoside permease
RA	2,248,657	C→A	100%	K3N (AAG→AAT)	rihB ←	ribonucleoside hydrolase 2
RA	2,253,174	T→A	62.8%	intergenic (‑399/+24)	psuK ← / ← fruA	pseudouridine kinase/fused fructose‑specific PTS enzymes: IIBcomponent/IIC components
RA	2,263,137	C→A	100%	intergenic (+91/‑321)	lpxT → / → mepS	lipid A 1‑diphosphate synthase; undecaprenyl pyrophosphate:lipid A 1‑phosphate phosphotransferase/murein DD‑endopeptidase, space‑maker hydrolase, mutational suppressor of prc thermosensitivity, outer membrane lipoprotein
RA	2,264,143	G→A	100%	intergenic (+119/‑62)	mepS → / → rtn	murein DD‑endopeptidase, space‑maker hydrolase, mutational suppressor of prc thermosensitivity, outer membrane lipoprotein/resistance protein for phages lambda and N4, putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA	2,269,345	C→A	8.0%	V198V (GTC→GTA)	yejE →	microcin C transporter YejABEF, permease subunit; ABC family
RA	2,270,918	C→A	28.3%	N380K (AAC→AAA)	yejF →	microcin C transporter, ATP‑binding subunit; ABC family
RA	2,287,829	C→A	100%	S185S (TCG→TCT)	ccmF ←	heme lyase, CcmF subunit
RA	2,289,043	C→A	100%	W8L (TGG→TTG)	ccmD ←	cytochrome c biogenesis protein
RA	2,289,374	C→A	100%	V142V (GTG→GTT)	ccmC ←	heme exporter subunit
RA	2,294,862	G→T	28.2%	I457I (ATC→ATA)	napA ←	nitrate reductase, periplasmic, large subunit
RA	2,298,128	C→T	6.1%	intergenic (+256/+459)	eco → / ← mqo	ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain
RA	2,303,070	T→G	100%	Q272P (CAG→CCG)	ada ←	fused DNA‑binding transcriptional dual regulator/O6‑methylguanine‑DNA methyltransferase
RA	2,305,116	C→A	100%	intergenic (‑103/+9)	apbE ← / ← ompC	putative thiamine‑synthetic flavin transferase lipoprotein/outer membrane porin protein C
RA	2,305,135	T→C	100%	Y365C (TAC→TGC)	ompC ←	outer membrane porin protein C
RA	2,310,875	A→T	26.7%	I827I (ATT→ATA)	rcsC ←	hybrid sensory kinase in two‑component regulatory system with RcsB and YojN
RA	2,311,982	C→A	28.7%	E458D (GAG→GAT)	rcsC ←	hybrid sensory kinase in two‑component regulatory system with RcsB and YojN
RA	2,313,625	T→A	6.0%	V35E (GTA→GAA)	atoS →	sensory histidine kinase in two‑component regulatory system with AtoC
RA	2,318,825	G→T	100%	V197V (GTG→GTT)	atoE →	short chain fatty acid transporter
RA	2,319,752	C→A	100%	N55K (AAC→AAA)	atoB →	acetyl‑CoA acetyltransferase
RA	2,320,529	T→A	6.2%	I314I (ATT→ATA)	atoB →	acetyl‑CoA acetyltransferase
RA	2,322,609	C→A	100%	W223L (TGG→TTG)	yfaQ ←	tandem DUF2300 domain protein, putative host defense protein
RA	2,330,502	C→A	100%	D800Y (GAT→TAT)	gyrA ←	DNA gyrase (type II topoisomerase), subunit A
RA	2,334,722	C→A	10.4%	R976L (CGA→CTA)	yfaL ←	adhesin
RA	2,338,233	A→C	57.0%	intergenic (‑585/‑111)	yfaL ← / → nrdA	adhesin/ribonucleoside‑diphosphate reductase 1, alpha subunit
RA	2,339,641	T→A	21.8%	V433E (GTG→GAG)	nrdA →	ribonucleoside‑diphosphate reductase 1, alpha subunit
RA	2,341,226	T→A	8.5%	S122T (TCC→ACC)	nrdB →	ribonucleoside‑diphosphate reductase 1, beta subunit, ferritin‑like protein
RA	2,342,897	C→A	100%	D19Y (GAC→TAC)	inaA ←	acid‑inducible Kdo/WaaP family putative kinase
RA	2,348,894	T→A	100%	V384E (GTG→GAG)	glpB →	sn‑glycerol‑3‑phosphate dehydrogenase (anaerobic), membrane anchor subunit
RA	2,352,573	C→A	100%	P353P (CCG→CCT)	rhmT ←	putative L‑rhamnonate transporter
RA	2,358,641	G→T	100%	I153I (ATC→ATA)	ais ←	putative LPS core heptose(II)‑phosphate phosphatase
RA	2,359,147	T→A	10.7%	intergenic (‑48/‑260)	ais ← / → arnB	putative LPS core heptose(II)‑phosphate phosphatase/uridine 5'‑(beta‑1‑threo‑pentapyranosyl‑4‑ulose diphosphate) aminotransferase, PLP‑dependent
RA	2,359,673	G→T	100%	M89I (ATG→ATT)	arnB →	uridine 5'‑(beta‑1‑threo‑pentapyranosyl‑4‑ulose diphosphate) aminotransferase, PLP‑dependent
RA	2,362,338	T→A	100%	L274Q (CTG→CAG)	arnA →	fused UDP‑L‑Ara4N formyltransferase/UDP‑GlcA C‑4'‑decarboxylase
RA	2,370,361:1	+G	100%	coding (711/759 nt)	menH ←	2‑succinyl‑6‑hydroxy‑2, 4‑cyclohexadiene‑1‑carboxylate synthase
RA	2,370,765	G→C	58.6%	L103V (CTT→GTT)	menH ←	2‑succinyl‑6‑hydroxy‑2, 4‑cyclohexadiene‑1‑carboxylate synthase
RA	2,370,840	G→A	11.5%	L78F (CTT→TTT)	menH ←	2‑succinyl‑6‑hydroxy‑2, 4‑cyclohexadiene‑1‑carboxylate synthase
RA	2,370,987	C→A	100%	E29* (GAA→TAA)	menH ←	2‑succinyl‑6‑hydroxy‑2, 4‑cyclohexadiene‑1‑carboxylate synthase
RA	2,374,303	T→G	7.3%	A68A (GCA→GCC)	elaB ←	DUF883 family protein, putative membrane‑anchored ribosome‑binding protein
RA	2,376,959	C→T	100%	N256N (AAC→AAT)	elaD →	protease, capable of cleaving an AMC‑ubiquitin model substrate
RA	2,380,078	C→T	100%	S247F (TCT→TTT)	yfbL →	putative peptidase
RA	2,383,897	C→A	100%	R363L (CGC→CTC)	nuoN ←	NADH:ubiquinone oxidoreductase, membrane subunit N
RA	2,399,210	G→T	100%	S304* (TCA→TAA)	lrhA ←	transcriptional repressor of flagellar, motility and chemotaxis genes
RA	2,400,858	C→A	100%	intergenic (‑738/‑182)	lrhA ← / → alaA	transcriptional repressor of flagellar, motility and chemotaxis genes/valine‑pyruvate aminotransferase 2
RA	2,400,876	C→T	17.0%	intergenic (‑756/‑164)	lrhA ← / → alaA	transcriptional repressor of flagellar, motility and chemotaxis genes/valine‑pyruvate aminotransferase 2
RA	2,404,772	C→A	100%	A20A (GCG→GCT)	yfbS ←	putative transporter
RA	2,405,946	T→G	100%	Q43P (CAG→CCG)	yfbU ←	UPF0304 family protein
RA	2,409,935	G→T	68.2%	A570A (GCG→GCT)	pta →	phosphate acetyltransferase
RA	2,410,089	G→T	6.6%	D622Y (GAC→TAC)	pta →	phosphate acetyltransferase
RA	2,411,263	T→A	11.7%	V235E (GTG→GAG)	yfcC →	putative inner membrane transporter, C4‑dicarboxylate anaerobic carrier family
RA	2,411,273	C→A	12.5%	I238I (ATC→ATA)	yfcC →	putative inner membrane transporter, C4‑dicarboxylate anaerobic carrier family
RA	2,411,701	T→A	27.8%	L381* (TTA→TAA)	yfcC →	putative inner membrane transporter, C4‑dicarboxylate anaerobic carrier family
RA	2,412,205	C→A	100%	D151Y (GAT→TAT)	yfcD ←	putative NUDIX hydrolase
RA	2,416,101	C→A	100%	intergenic (+21/+27)	yfcH → / ← yfcI	putative NAD‑dependent nucleotide‑sugar epimerase/transposase_31 family protein
RA	2,419,993	G→T	24.8%	S92* (TCG→TAG)	hisJ ←	histidine/lysine/arginine/ornithine transporter subunit
RA	2,422,841	C→A	100%	D293Y (GAT→TAT)	purF ←	amidophosphoribosyltransferase
RA	2,424,074	C→T	100%	D57N (GAC→AAC)	cvpA ←	colicin V production membrane protein
RA	2,424,448	A→C	32.1%	intergenic (‑206/+53)	cvpA ← / ← dedD	colicin V production membrane protein/membrane‑anchored periplasmic protein involved in septation
RA	2,427,265	C→A	25.3%	P47P (CCG→CCT)	accD ←	acetyl‑CoA carboxylase, beta (carboxyltransferase) subunit
RA	2,428,546	C→A	28.2%	V190V (GTG→GTT)	truA ←	tRNA pseudouridine(38‑40) synthase
RA	2,450,335	C→T	100%	intergenic (‑44/+159)	sixA ← / ← fadJ	phosphohistidine phosphatase/fused enoyl‑CoA hydratase and epimerase and isomerase/3‑hydroxyacyl‑CoA dehydrogenase
RA	2,450,346	G→T	100%	intergenic (‑55/+148)	sixA ← / ← fadJ	phosphohistidine phosphatase/fused enoyl‑CoA hydratase and epimerase and isomerase/3‑hydroxyacyl‑CoA dehydrogenase
RA	2,450,770	C→A	10.6%	V623V (GTG→GTT)	fadJ ←	fused enoyl‑CoA hydratase and epimerase and isomerase/3‑hydroxyacyl‑CoA dehydrogenase
RA	2,452,454	G→T	100%	P62Q (CCG→CAG)	fadJ ←	fused enoyl‑CoA hydratase and epimerase and isomerase/3‑hydroxyacyl‑CoA dehydrogenase
RA	2,454,297	T→G	100%	E39D (GAA→GAC)	yfcZ ←	UPF0381 family protein
RA	2,456,705	C→A	100%	S72Y (TCC→TAC)	yfdF →	uncharacterized protein
RA	2,459,976	G→T	100%	intergenic (+114/‑48)	argW → / → intS	tRNA‑Arg/CPS‑53 (KpLE1) prophage; putative prophage CPS‑53 integrase
RA	2,463,906	C→A	13.0%	Q433K (CAA→AAA)	gtrS →	serotype‑specific glucosyl transferase, CPS‑53 (KpLE1) prophage
RA	2,463,910	G→T	10.0%	R434I (AGA→ATA)	gtrS →	serotype‑specific glucosyl transferase, CPS‑53 (KpLE1) prophage
RA	2,463,915	C→A	11.5%	Q436K (CAA→AAA)	gtrS →	serotype‑specific glucosyl transferase, CPS‑53 (KpLE1) prophage
RA	2,467,970	G→T	59.7%	D154Y (GAC→TAC)	yfdQ →	CPS‑53 (KpLE1) prophage; uncharacterized protein
RA	2,474,255	T→A	18.6%	E467D (GAA→GAT)	emrY ←	putative multidrug efflux system
RA	2,474,353	G→T	100%	Q435K (CAG→AAG)	emrY ←	putative multidrug efflux system
RA	2,474,418	G→T	100%	S413* (TCA→TAA)	emrY ←	putative multidrug efflux system
RA	2,475,279	A→T	14.7%	L126Q (CTG→CAG)	emrY ←	putative multidrug efflux system
RA	2,476,524	T→A	100%	N99Y (AAT→TAT)	emrK ←	EmrKY‑TolC multidrug resistance efflux pump, membrane fusion protein component
RA	2,478,201	G→T	26.8%	E117* (GAA→TAA)	evgS →	hybrid sensory histidine kinase in two‑component regulatory system with EvgA
RA	2,480,932	A→C	6.3%	Q1027P (CAA→CCA)	evgS →	hybrid sensory histidine kinase in two‑component regulatory system with EvgA
RA	2,481,488	A→T	29.5%	intergenic (+42/+14)	evgS → / ← yfdE	hybrid sensory histidine kinase in two‑component regulatory system with EvgA/acetyl‑CoA:oxalate CoA‑transferase
RA	2,481,974	G→T	100%	S225* (TCA→TAA)	yfdE ←	acetyl‑CoA:oxalate CoA‑transferase
RA	2,488,416	G→T	100%	P80P (CCG→CCT)	ypdI →	putative lipoprotein involved in colanic acid biosynthesis
RA	2,488,443	T→A	11.3%	P89P (CCT→CCA)	ypdI →	putative lipoprotein involved in colanic acid biosynthesis
RA	2,497,475	C→A	5.0%	E164* (GAG→TAG)	fryA ←	putative PTS enzyme, Hpr component/enzyme I component/enzyme IIA component
RA	2,497,946	G→T	100%	L7I (CTC→ATC)	fryA ←	putative PTS enzyme, Hpr component/enzyme I component/enzyme IIA component
RA	2,499,180	G→T	22.6%	T311K (ACG→AAG)	ypdF ←	Xaa‑Pro aminopeptidase
RA	2,499,568	C→A	100%	D182Y (GAC→TAC)	ypdF ←	Xaa‑Pro aminopeptidase
RA	2,512,031	C→A	13.1%	S29* (TCA→TAA)	yfeC →	DUF1323 family putative DNA‑binding protein
RA	2,512,279	G→T	59.3%	D112Y (GAT→TAT)	yfeC →	DUF1323 family putative DNA‑binding protein
RA	2,513,935	A→T	68.6%	Y73N (TAC→AAC)	gltX ←	glutamyl‑tRNA synthetase
RA	2,520,652	C→A	100%	I116I (ATC→ATA)	yfeH →	putative inorganic ion transporter
RA	2,521,009	C→A	8.4%	V235V (GTC→GTA)	yfeH →	putative inorganic ion transporter
RA	2,524,056	C→A	100%	A179A (GCG→GCT)	zipA ←	FtsZ stabilizer
RA	2,526,794	C→T	100%	intergenic (+55/‑329)	cysK → / → ptsH	cysteine synthase A, O‑acetylserine sulfhydrolase A subunit/phosphohistidinoprotein‑hexose phosphotransferase component of PTS system (Hpr)
RA	2,526,934	C→A	10.2%	intergenic (+195/‑189)	cysK → / → ptsH	cysteine synthase A, O‑acetylserine sulfhydrolase A subunit/phosphohistidinoprotein‑hexose phosphotransferase component of PTS system (Hpr)
RA	2,532,553	C→A	5.3%	A130A (GCG→GCT)	cysM ←	cysteine synthase B (O‑acetylserine sulfhydrolase B)
RA	2,542,627	T→G	100%	I389M (ATT→ATG)	yfeW →	penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity
RA	2,546,198	T→G	28.8%	L163R (CTG→CGG)	amiA →	N‑acetylmuramoyl‑l‑alanine amidase I
RA	2,547,821	A→C	7.3%	L241V (TTG→GTG)	eutR ←	eut operon transcriptional activator, AraC family
RA	2,549,144	C→A	27.2%	D206Y (GAT→TAT)	eutL ←	putative ethanol utilization carboxysome structural protein
RA	2,549,676	C→A	100%	L28L (CTG→CTT)	eutL ←	putative ethanol utilization carboxysome structural protein
RA	2,552,461	A→G	58.1%	N82S (AAT→AGT)	intZ →	CPZ‑55 prophage; putative phage integrase
RA	2,555,735	G→T	8.3%	R89L (CGA→CTA)	yffO →	CPZ‑55 prophage; uncharacterized protein
RA	2,556,744	T→C	7.9%	intergenic (+268/‑207)	yffP → / → yffQ	CPZ‑55 prophage; uncharacterized protein/CPZ‑55 prophage; uncharacterized protein
RA	2,556,786	G→T	100%	intergenic (+310/‑165)	yffP → / → yffQ	CPZ‑55 prophage; uncharacterized protein/CPZ‑55 prophage; uncharacterized protein
RA	2,564,340	G→T	9.2%	I257I (ATC→ATA)	eutE ←	aldehyde oxidoreductase, ethanolamine utilization protein
RA	2,567,211	C→A	100%	D152Y (GAT→TAT)	eutT ←	cobalamin adenosyltransferase involved in ethanolamine utilization
RA	2,567,775	G→T	32.5%	I196I (ATC→ATA)	eutQ ←	RmlC‑like cupin domain protein
RA	2,568,720	C→T	100%	A33T (GCC→ACC)	eutP ←	putative P‑loop NTPase ethanolamine utilization protein
RA	2,574,820	C→A	100%	A609E (GCG→GAG)	tktB →	transketolase 2, thiamine triphosphate‑binding
RA	2,576,325	C→A	100%	E171D (GAG→GAT)	nudK ←	GDP‑mannose pyrophosphatase
RA	2,579,561	G→T	100%	G158C (GGC→TGC)	narQ →	sensory histidine kinase in two‑component regulatory system with NarP (NarL)
RA	2,587,029:1	+G	100%	coding (101/699 nt)	ypfH ←	palmitoyl‑CoA esterase activity, uncertain physiological substrate
RA	2,589,933	G→A	100%	T55I (ACC→ATC)	ypfJ ←	putative neutral zinc metallopeptidase
RA	2,597,173	T→G	100%	L666R (CTG→CGG)	hyfB →	hydrogenase 4, membrane subunit
RA	2,601,496	T→A	28.3%	F407L (TTT→TTA)	hyfF →	hydrogenase 4, membrane subunit
RA	2,601,971	C→A	9.3%	I42I (ATC→ATA)	hyfG →	hydrogenase 4, subunit
RA	2,604,776	A→T	6.9%	S238C (AGT→TGT)	hyfI →	hydrogenase 4, Fe‑S subunit
RA	2,605,760	C→A	5.3%	L168I (CTT→ATT)	hyfR →	hydrogenase‑4 transcriptional activator
RA	2,606,516	G→T	100%	D420Y (GAC→TAC)	hyfR →	hydrogenase‑4 transcriptional activator
RA	2,610,919	C→A	100%	intergenic (+3/‑18)	bepA → / → yfgD	periplasmic metalloprotease and chaperone for OM protein maintenance and assembly/putative oxidoreductase
RA	2,614,168	C→A	100%	D22Y (GAT→TAT)	upp ←	uracil phosphoribosyltransferase
RA	2,618,693	G→T	100%	E74* (GAA→TAA)	ppx →	exopolyphosphatase
RA	2,626,389	G→T	23.0%	I347I (ATC→ATA)	guaB ←	IMP dehydrogenase
RA	2,632,012	C→A	100%	intergenic (‑1/+10)	bamB ← / ← yfgM	BamABCDE complex OM biogenesis lipoprotein/putative anti‑RcsB factor
RA	2,633,402	C→A	100%	R178L (CGC→CTC)	hisS ←	histidyl tRNA synthetase
RA	2,634,417	T→G	23.1%	K249N (AAA→AAC)	ispG ←	1‑hydroxy‑2‑methyl‑2‑(E)‑butenyl 4‑diphosphate synthase
RA	2,639,116	C→A	100%	A523A (GCG→GCT)	pbpC ←	penicillin‑insensitive murein repair transglycosylase; inactive transpeptidase domain
RA	2,643,336	C→A	100%	D771Y (GAC→TAC)	yfhM ←	bacterial alpha2‑macroglobulin colonization factor ECAM; anti‑host protease defense factor; periplasmic inner membrane‑anchored lipoprotein
RA	2,645,592	C→A	100%	D19Y (GAC→TAC)	yfhM ←	bacterial alpha2‑macroglobulin colonization factor ECAM; anti‑host protease defense factor; periplasmic inner membrane‑anchored lipoprotein
RA	2,651,665	G→T	100%	G210G (GGC→GGA)	hscA ←	DnaK‑like molecular chaperone specific for IscU
RA	2,655,084	A→C	31.3%	L136R (CTG→CGG)	iscR ←	isc operon transcriptional repressor; suf operon transcriptional activator; oxidative stress‑ and iron starvation‑inducible; autorepressor
RA	2,659,594	C→A	100%	L267L (CTC→CTA)	csiE →	stationary phase inducible protein
RA	2,664,138	A→C	28.0%	E130D (GAA→GAC)	hcaF →	3‑phenylpropionate dioxygenase, small (beta) subunit
RA	2,665,772	G→T	100%	E123* (GAA→TAA)	hcaD →	phenylpropionate dioxygenase, ferredoxin reductase subunit
RA	2,668,397	C→A	69.5%	G242C (GGT→TGT)	yphC ←	putative Zn‑dependent NAD(P)‑binding oxidoreductase
RA	2,669,978	C→A	100%	A69A (GCG→GCT)	yphD ←	inner membrane putative ABC superfamily sugar transporter permease
RA	2,671,274	C→A	100%	T149T (ACG→ACT)	yphE ←	putative sugar transporter subunit of ABC superfamily, ATP‑binding component
RA	2,679,371	G→T	6.5%	A60S (GCT→TCT)	hmp →	fused nitric oxide dioxygenase/dihydropteridine reductase 2
RA	2,681,873	T→A	100%	Q97L (CAG→CTG)	glrR ←	response regulator regulating glmY sRNA in two‑component system with sensor protein GlrK
RA	2,683,829	C→A	100%	R210L (CGT→CTT)	glrK ←	sensor protein kinase regulating glmY sRNA in two‑component system with response regulator GlrR
RA	2,688,006	C→A	100%	P299P (CCG→CCT)	purL ←	phosphoribosylformyl‑glycineamide synthetase
RA	2,689,267	C→A	100%	I36I (ATC→ATA)	mltF →	membrane‑bound lytic transglycosylase F, murein hydrolase
RA	2,691,904	T→A	27.8%	A2A (GCA→GCT)	pgpC ←	phosphatidylglycerophosphatase C, membrane bound
RA	2,692,793	C→A	100%	H226N (CAT→AAT)	yfhH →	putative DNA‑binding transcriptional regulator
RA	2,694,843	G→T	100%	I82I (ATC→ATA)	pdxJ ←	pyridoxine 5'‑phosphate synthase
RA	2,699,380	C→A	100%	P368P (CCG→CCT)	lepA ←	back‑translocating elongation factor EF4, GTPase
RA	2,699,880	T→A	100%	N202Y (AAC→TAC)	lepA ←	back‑translocating elongation factor EF4, GTPase
JC JC	2,709,656	IS2 (–) +5 bp	100%	coding (149‑153/384 nt)	grcA ←	autonomous glycyl radical cofactor
RA	2,711,755	C→A	100%	D45Y (GAC→TAC)	yfiF ←	putative methyltransferase
RA	2,712,342	T→A	11.5%	G83G (GGT→GGA)	trxC →	thioredoxin 2
RA	2,715,643	G→T	100%	E778* (GAA→TAA)	pka →	protein lysine acetyltransferase
RA	2,719,426	T→C	100%	intergenic (‑321/+2)	kgtP ← / ← rrfG	alpha‑ketoglutarate transporter/5S ribosomal RNA of rrnG operon
RA	2,725,747	G→T	100%	R596S (CGC→AGC)	clpB ←	protein disaggregation chaperone
RA	2,726,786	C→A	100%	A249A (GCG→GCT)	clpB ←	protein disaggregation chaperone
RA	2,727,416	C→A	100%	L39L (CTG→CTT)	clpB ←	protein disaggregation chaperone
RA	2,730,042	T→G	58.8%	S180A (TCC→GCC)	bamD →	BamABCDE complex OM biogenesis lipoprotein
RA	2,733,753	C→T	100%	E253K (GAG→AAG)	aroF ←	3‑deoxy‑D‑arabino‑heptulosonate‑7‑phosphate synthase, tyrosine‑repressible
RA	2,736,714	C→A	100%	R325S (CGC→AGC)	yfiN →	putative membrane‑anchored diguanylate cyclase with an N‑terminal periplasmic domain
RA	2,742,155	C→A	5.9%	T8K (ACG→AAG)	yfjD →	UPF0053 family inner membrane protein
RA	2,743,438	C→A	100%	intergenic (+19/+36)	yfjD → / ← grpE	UPF0053 family inner membrane protein/heat shock protein
RA	2,751,558	G→T	100%	T134T (ACC→ACA)	yfjH ←	CP4‑57 prophage; uncharacterized protein
JC	2,758,771	Δ8 bp	8.2%	intergenic (‑259/+94)	yfjL ← / ← yfjM	CP4‑57 putative defective prophage, DUF4297/DUF1837 polymorphic toxin family protein/CP4‑57 prophage; uncharacterized protein
RA	2,763,057	C→A	100%	intergenic (+212/‑5)	yfjQ → / → yfjR	CP4‑57 prophage; uncharacterized protein/CP4‑57 prophage; putative DNA‑binding transcriptional regulator
RA	2,765,064	T→A	7.8%	intergenic (+90/+297)	yfjT → / ← yfjU	CP4‑57 prophage; putative periplasmic protein/CP4‑57 prophage; conserved protein;Phage or Prophage Related
RA	2,771,358	G→A	100%	intergenic (+217/+147)	ypjF → / ← ypjA	CP4‑57 prophage; toxin of the YpjF‑YfjZ toxin‑antitoxin system/adhesin‑like autotransporter
RA	2,778,820	G→A	100%	intergenic (‑450/+301)	ypjC ← / ← ileY	pseudogene/tRNA‑Ile
RA	2,779,067	C→A	100%	intergenic (‑697/+54)	ypjC ← / ← ileY	pseudogene/tRNA‑Ile
RA	2,792,318	C→A	10.2%	intergenic (‑464/‑205)	stpA ← / → alaE	DNA binding protein, nucleoid‑associated/alanine exporter, alanine‑inducible, stress‑responsive
RA	2,798,195	A→T	100%	K8* (AAA→TAA)	proV →	glycine betaine transporter subunit
RA	2,801,418	T→G	10.6%	W310G (TGG→GGG)	proX →	glycine betaine transporter subunit
RA	2,801,706	C→A	100%	pseudogene (32/1178 nt)	ygaY →	pseudogene, major facilitator transporter superfamily;putative transport; Not classified; putative transport protein
RA	2,808,907	C→A	100%	E298* (GAA→TAA)	gshA ←	glutamate‑cysteine ligase
JC	2,811,717	Δ134 bp	8.0%		[argV]	[argV]
RA	2,825,783	C→T	100%	intergenic (‑135/‑52)	norR ← / → norV	anaerobic nitric oxide reductase DNA‑binding transcriptional activator/anaerobic nitric oxide reductase flavorubredoxin
RA	2,828,952	C→A	100%	T611T (ACG→ACT)	hypF ←	carbamoyl phosphate phosphatase and maturation protein for [NiFe] hydrogenases
RA	2,831,086	C→A	100%	E127* (GAA→TAA)	hydN ←	formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA	2,831,929	T→A	100%	E232V (GAA→GTA)	ascG ←	asc operon transcriptional repressor; prpBC operon repressor
RA	2,832,734	A→G	35.8%	intergenic (‑111/‑149)	ascG ← / → ascF	asc operon transcriptional repressor; prpBC operon repressor/fused cellobiose/arbutin/salicin‑specific PTS enzymes: IIB component/IC component
RA	2,834,052	C→A	27.5%	I390I (ATC→ATA)	ascF →	fused cellobiose/arbutin/salicin‑specific PTS enzymes: IIB component/IC component
RA	2,834,252	A→T	7.1%	E457V (GAG→GTG)	ascF →	fused cellobiose/arbutin/salicin‑specific PTS enzymes: IIB component/IC component
RA	2,835,094	C→A	100%	P249Q (CCG→CAG)	ascB →	cryptic 6‑phospho‑beta‑glucosidase
RA	2,836,554	G→T	100%	I84I (ATC→ATA)	hycH ←	hydrogenase 3 maturation protein
RA	2,837,721	C→A	100%	D131Y (GAC→TAC)	hycF ←	formate hydrogenlyase complex iron‑sulfur protein
RA	2,841,044	C→A	100%	A519A (GCG→GCT)	hycC ←	hydrogenase 3, membrane subunit
RA	2,844,024	T→A	59.7%	C7S (TGC→AGC)	hypA →	protein involved in nickel insertion into hydrogenases 3
RA	2,846,112	C→A	100%	I206I (ATC→ATA)	hypD →	hydrogenase maturation protein
RA	2,848,002	T→A	100%	C102* (TGT→TGA)	fhlA →	formate hydrogenlyase transcriptional activator
RA	2,850,790	C→A	100%	I113I (ATC→ATA)	mutS →	methyl‑directed mismatch repair protein
RA	2,852,854	G→T	100%	P801P (CCG→CCT)	mutS →	methyl‑directed mismatch repair protein
RA	2,855,673	C→A	14.0%	I295I (ATC→ATA)	ygbJ →	putative dehydrogenase
RA	2,863,542	A→T	18.6%	V31E (GTG→GAG)	umpG ←	broad specificity 5'(3')‑nucleotidase and polyphosphatase
RA	2,869,780	G→A	100%	intergenic (‑92/‑160)	cysD ← / → iap	sulfate adenylyltransferase, subunit 2/aminopeptidase in alkaline phosphatase isozyme conversion
RA	2,870,278	C→A	100%	I113I (ATC→ATA)	iap →	aminopeptidase in alkaline phosphatase isozyme conversion
RA	2,871,577	C→A	16.8%	intergenic (+600/+351)	iap → / ← ygbF	aminopeptidase in alkaline phosphatase isozyme conversion/CRISPR adaptation ssRNA endonuclease
RA	2,873,087	G→T	100%	V15V (GTC→GTA)	ygbT ←	multifunctional endonuclease Cas1, CRISPR adaptation protein; DNA repair enzyme
RA	2,876,760	C→T	100%	G246G (GGG→GGA)	casA ←	CRISP RNA (crRNA) containing Cascade antiviral complex protein
RA	2,878,098	T→A	57.1%	A827A (GCA→GCT)	ygcB ←	R‑loop helicase‑annealase Cas3 needed for Cascade anti‑viral activity
RA	2,878,668	G→T	100%	V637V (GTC→GTA)	ygcB ←	R‑loop helicase‑annealase Cas3 needed for Cascade anti‑viral activity
RA	2,879,449	G→T	100%	S377* (TCA→TAA)	ygcB ←	R‑loop helicase‑annealase Cas3 needed for Cascade anti‑viral activity
RA	2,880,751	C→A	100%	noncoding (39/56 nt)	sokX →	sok‑related sRNA, function unknown
RA	2,881,078	G→T	71.0%	G198G (GGC→GGA)	cysH ←	phosphoadenosine phosphosulfate reductase; PAPS reductase, thioredoxin dependent
RA	2,881,660	G→T	14.5%	L4L (CTC→CTA)	cysH ←	phosphoadenosine phosphosulfate reductase; PAPS reductase, thioredoxin dependent
RA	2,884,385	G→T	100%	V291V (GTC→GTA)	cysJ ←	sulfite reductase, alpha subunit, flavoprotein
RA	2,888,584	G→T	100%	I185I (ATC→ATA)	ygcQ ←	putative flavoprotein
RA	2,889,129	C→A	100%	A4S (GCA→TCA)	ygcQ ←	putative flavoprotein
RA	2,893,402	T→A	6.6%	A77A (GCA→GCT)	ygcW ←	putative dehydrogenase
RA	2,893,446	T→A	100%	K63* (AAA→TAA)	ygcW ←	putative dehydrogenase
RA	2,894,388	C→A	61.0%	V146V (GTC→GTA)	yqcE →	MFS transporter family protein
RA	2,902,302	C→A	73.5%	D242Y (GAT→TAT)	pyrG ←	CTP synthetase
RA	2,909,577	T→G	6.0%	L388V (TTA→GTA)	barA →	hybrid sensory histidine kinase, in two‑component regulatory system with UvrY
RA	2,913,019	C→A	100%	A363S (GCT→TCT)	gudX ←	glucarate dehydratase‑related protein, substrate unknown
RA	2,913,502	C→A	58.7%	D202Y (GAT→TAT)	gudX ←	glucarate dehydratase‑related protein, substrate unknown
RA	2,914,467	T→G	58.5%	V331V (GTA→GTC)	gudP ←	putative D‑glucarate transporter
RA	2,915,998	C→A	100%	A116S (GCT→TCT)	yqcA ←	short‑chain flavodoxin, FMN‑binding
RA	2,918,415	G→A	100%	P75P (CCC→CCT)	syd ←	SecY‑interacting protein
RA	2,919,922	G→T	100%	D86Y (GAT→TAT)	ygdH →	UPF0717 family protein
RA	2,920,050	C→A	100%	I128I (ATC→ATA)	ygdH →	UPF0717 family protein
RA	2,921,101	C→A	100%	intergenic (+70/‑487)	ygdH → / → sdaC	UPF0717 family protein/putative serine transporter
RA	2,921,245	G→T	100%	intergenic (+214/‑343)	ygdH → / → sdaC	UPF0717 family protein/putative serine transporter
RA	2,931,717	C→A	100%	N307K (AAC→AAA)	fucK →	L‑fuculokinase
RA	2,932,236	G→T	12.4%	E480D (GAG→GAT)	fucK →	L‑fuculokinase
RA	2,932,835	C→T	100%	R37C (CGC→TGC)	fucR →	l‑fucose operon activator
RA	2,934,843	G→T	100%	H50N (CAT→AAT)	ygdD ←	UPF0382 family inner membrane protein
RA	2,936,836	C→A	100%	A47A (GCC→GCA)	csdA →	cysteine sulfinate desulfinase
RA	2,939,313	G→T	60.4%	intergenic (‑112/+127)	tcdA ← / ← mltA	tRNA threonylcarbamoyladenosine dehydratase; sulfur acceptor for CsdA/membrane‑bound lytic murein transglycosylase A
RA	2,939,832	C→A	28.0%	E236* (GAA→TAA)	mltA ←	membrane‑bound lytic murein transglycosylase A
RA	2,939,859	Δ1 bp	6.4%	coding (679/1098 nt)	mltA ←	membrane‑bound lytic murein transglycosylase A
RA	2,939,961	T→G	38.0%	S193R (AGT→CGT)	mltA ←	membrane‑bound lytic murein transglycosylase A
RA	2,941,341	G→A	100%	L343L (CTC→CTT)	amiC ←	N‑acetylmuramoyl‑L‑alanine amidase
RA	2,945,306	C→G	100%	G172A (GGC→GCC)	recD ←	exonuclease V (RecBCD complex), alpha chain
RA	2,950,431	T→A	30.1%	N605Y (AAT→TAT)	ptrA ←	protease III
RA	2,959,004	G→A	100%	I131I (ATC→ATT)	lgt ←	phosphatidylglycerol‑prolipoprotein diacylglyceryl transferase
RA	2,962,962	T→A	100%	intergenic (‑626/‑59)	rppH ← / → mutH	RNA pyrophosphohydrolase/methyl‑directed mismatch repair protein
RA	2,973,968	T→A	54.0%	G9G (GGA→GGT)	ygeA ←	Asp/Glu_racemase family protein
RA	2,974,073	C→T	100%	intergenic (‑79/+50)	ygeA ← / ← araE	Asp/Glu_racemase family protein/arabinose transporter
RA	2,980,488	C→A	100%	intergenic (+53/‑407)	yqeG → / → yqeH	putative transporter/putative LuxR family transcriptional regulator
RA	2,983,568	C→A	22.5%	R51I (AGA→ATA)	yqeK ←	uncharacterized protein
RA	2,984,747	G→T	100%	D41Y (GAT→TAT)	ygeG →	SycD‑like chaperone family TPR‑repeat‑containing protein
RA	2,985,256	G→T	100%	intergenic (+138/‑197)	ygeG → / → ygeH	SycD‑like chaperone family TPR‑repeat‑containing protein/putative transcriptional regulator
RA	2,985,472	T→A	26.5%	F7Y (TTC→TAC)	ygeH →	putative transcriptional regulator
RA	2,985,884	C→T	100%	I144I (ATC→ATT)	ygeH →	putative transcriptional regulator
RA	2,986,052	G→T	100%	L200F (TTG→TTT)	ygeH →	putative transcriptional regulator
RA	2,988,355	C→A	100%	pseudogene (97/633 nt)	ygeK ←	pseudogene; putative 2‑component transcriptional regulator
RA	2,988,554	G→A	100%	intergenic (‑103/+119)	ygeK ← / ← ygeN	pseudogene; putative 2‑component transcriptional regulator/pseudogene
RA	2,988,934	G→T	28.2%	pseudogene (186/447 nt)	ygeN ←	pseudogene
RA	2,989,295	C→A	100%	pseudogene (85/261 nt)	ygeN ←	pseudogene
RA	2,993,211	C→A	100%	V14L (GTG→TTG)	ygeR ←	LysM domain‑containing M23 family putative peptidase; septation lipoprotein
RA	2,993,699	C→A	100%	intergenic (‑449/‑5)	ygeR ← / → xdhA	LysM domain‑containing M23 family putative peptidase; septation lipoprotein/xanthine dehydrogenase, molybdenum binding subunit
RA	2,999,827	C→A	100%	D69E (GAC→GAA)	ygeW →	putative carbamoyltransferase
RA	3,000,265	G→T	6.0%	M215I (ATG→ATT)	ygeW →	putative carbamoyltransferase
RA	3,009,187	G→T	100%	intergenic (+90/‑232)	mocA → / → ygfK	CTP:molybdopterin cytidylyltransferase/putative Fe‑S subunit oxidoreductase subunit
RA	3,010,667	G→T	30.4%	D417Y (GAC→TAC)	ygfK →	putative Fe‑S subunit oxidoreductase subunit
RA	3,017,285	G→T	100%	D871Y (GAC→TAC)	xdhD →	putative hypoxanthine oxidase, molybdopterin‑binding/Fe‑S binding
RA	3,018,544	G→T	100%	A279S (GCC→TCC)	xanQ →	xanthine permease
RA	3,022,562	C→T	100%	G577R (GGA→AGA)	ygfT ←	putative oxidoreductase, Fe‑S subunit/nucleotide‑binding subunit
RA	3,024,081	A→C	100%	V70V (GTT→GTG)	ygfT ←	putative oxidoreductase, Fe‑S subunit/nucleotide‑binding subunit
RA	3,024,983	C→G	100%	G86G (GGC→GGG)	uacT →	uric acid permease
RA	3,030,181	G→T	100%	H429N (CAT→AAT)	recJ ←	ssDNA exonuclease, 5' ‑‑> 3'‑specific
RA	3,030,592	T→A	65.6%	N292Y (AAT→TAT)	recJ ←	ssDNA exonuclease, 5' ‑‑> 3'‑specific
RA	3,039,409	T→G	10.1%	intergenic (‑149/+118)	ygfF ← / ← gcvP	putative NAD(P)‑dependent oxidoreductase with NAD(P)‑binding Rossmann‑fold domain/glycine decarboxylase, PLP‑dependent, subunit (protein P) of glycine cleavage complex
RA	3,039,703	C→A	100%	A900S (GCG→TCG)	gcvP ←	glycine decarboxylase, PLP‑dependent, subunit (protein P) of glycine cleavage complex
RA	3,040,479	T→G	13.1%	Q641P (CAG→CCG)	gcvP ←	glycine decarboxylase, PLP‑dependent, subunit (protein P) of glycine cleavage complex
RA	3,041,321	G→T	100%	I360I (ATC→ATA)	gcvP ←	glycine decarboxylase, PLP‑dependent, subunit (protein P) of glycine cleavage complex
RA	3,044,464	G→A	100%	intergenic (‑438/+10)	gcvT ← / ← ubiI	aminomethyltransferase, tetrahydrofolate‑dependent, subunit (T protein) of glycine cleavage complex/2‑octaprenylphenol hydroxylase, FAD‑dependent
RA	3,044,599	T→A	5.7%	T360S (ACC→TCC)	ubiI ←	2‑octaprenylphenol hydroxylase, FAD‑dependent
RA	3,049,220	C→A	100%	R84R (CGG→AGG)	zapA →	FtsZ stabilizer
RA	3,049,730	A→T	6.3%	D44V (GAT→GTT)	fau →	5‑formyltetrahydrofolate cyclo‑ligase family protein
RA	3,049,740	C→A	100%	L47L (CTC→CTA)	fau →	5‑formyltetrahydrofolate cyclo‑ligase family protein
RA	3,050,404	G→T	62.1%	intergenic (+57/+133)	sibC → / ← serA	sRNA antisense regulator of toxic IbsC protein/D‑3‑phosphoglycerate dehydrogenase
RA	3,058,769	C→T	100%	I203I (ATC→ATT)	scpC →	propionyl‑CoA:succinate CoA transferase
RA	3,062,143	G→A	7.2%	L9F (CTT→TTT)	argO ←	arginine transporter
RA	3,064,914	G→T	100%	I356I (ATC→ATA)	pgk ←	phosphoglycerate kinase
RA	3,065,123	C→T	100%	G287S (GGT→AGT)	pgk ←	phosphoglycerate kinase
RA	3,066,554	A→T	9.3%	L166* (TTG→TAG)	epd ←	D‑erythrose 4‑phosphate dehydrogenase
RA	3,068,690	C→A	23.1%	V284V (GTG→GTT)	yggF ←	fructose 1,6 bisphosphatase isozyme
RA	3,074,591	G→T	100%	A135E (GCG→GAG)	tktA ←	transketolase 1, thiamine triphosphate‑binding
RA	3,074,995	T→A	26.8%	intergenic (‑1/‑277)	tktA ← / → loiP	transketolase 1, thiamine triphosphate‑binding/Phe‑Phe periplasmic metalloprotease, OM lipoprotein; low salt‑inducible; heat shock protein that binds Era
RA	3,075,114	C→A	100%	intergenic (‑120/‑158)	tktA ← / → loiP	transketolase 1, thiamine triphosphate‑binding/Phe‑Phe periplasmic metalloprotease, OM lipoprotein; low salt‑inducible; heat shock protein that binds Era
RA	3,076,526	C→A	100%	D211Y (GAC→TAC)	speB ←	agmatinase
RA	3,077,302	C→A	100%	D657Y (GAT→TAT)	speA ←	biosynthetic arginine decarboxylase, PLP‑binding
RA	3,080,618	T→A	100%	V185E (GTG→GAG)	metK →	S‑adenosylmethionine synthetase
RA	3,081,604	C→T	5.1%	intergenic (+385/‑39)	metK → / → galP	S‑adenosylmethionine synthetase/D‑galactose transporter
RA	3,084,305	G→T	61.9%	K200N (AAG→AAT)	endA →	DNA‑specific endonuclease I
RA	3,084,798	C→A	100%	L102L (CTC→CTA)	rsmE →	16S rRNA m(3)U1498 methyltransferase, SAM‑dependent
RA	3,086,574	T→A	59.3%	F93L (TTT→TTA)	yqgE →	uncharacterized protein
RA	3,088,065	C→A	100%	V125V (GTG→GTT)	yggR ←	putative PilT family AAA+ ATPase
RA	3,097,262	C→T	100%	F297F (TTC→TTT)	mutY →	adenine DNA glycosylase
RA	3,098,052	C→A	8.8%	I87I (ATC→ATA)	mltC →	membrane‑bound lytic murein transglycosylase C
RA	3,098,230	T→A	5.2%	W147R (TGG→AGG)	mltC →	membrane‑bound lytic murein transglycosylase C
RA	3,106,685	G→T	100%	S51Y (TCT→TAT)	yghG ←	secretin (GspDbeta) OM localization lipoprotein pilotin
RA	3,107,261	C→A	11.9%	D151Y (GAT→TAT)	pppA ←	bifunctional prepilin leader peptidase/ methylase
RA	3,110,213	T→A	100%	A753A (GCA→GCT)	yghJ ←	DUF4092 family putative lipoprotein peptidase
RA	3,110,751	C→A	100%	R574L (CGT→CTT)	yghJ ←	DUF4092 family putative lipoprotein peptidase
RA	3,111,434	C→A	100%	A346A (GCG→GCT)	yghJ ←	DUF4092 family putative lipoprotein peptidase
RA	3,116,446	A→C	30.3%	L240R (CTG→CGG)	glcB ←	malate synthase G
RA	3,120,216	C→A	100%	D389Y (GAT→TAT)	glcD ←	glycolate oxidase subunit, FAD‑linked
RA	3,122,356	G→T	100%	L242F (TTG→TTT)	glcC →	glycolate‑inducible glc operon transcriptional repressor; autorepressor
RA	3,122,778	A→C	100%	pseudogene (725/1101 nt)	yghO ←	pseudogene, DNA‑binding transcriptional regulator homology
RA	3,134,528	C→A	100%	D40Y (GAT→TAT)	hybD ←	maturation protease for hydrogenase 2
RA	3,138,648	T→A	25.0%	N325Y (AAC→TAC)	hybO ←	hydrogenase 2, small subunit
RA	3,138,777	C→A	32.3%	G282C (GGT→TGT)	hybO ←	hydrogenase 2, small subunit
RA	3,142,668	G→T	100%	L55I (CTC→ATC)	yqhA ←	UPF0114 family putative inner membrane protein
RA	3,143,969	G→T	27.4%	intergenic (+64/+208)	yghA → / ← exbD	putative oxidoreductase/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA	3,144,158	C→A	100%	intergenic (+253/+19)	yghA → / ← exbD	putative oxidoreductase/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA	3,151,733	A→T	13.5%	D242V (GAT→GTT)	yqhG →	DUF3828 family putative periplasmic protein
RA	3,164,230	C→A	100%	R130S (CGT→AGT)	qseC →	quorum sensing sensory histidine kinase in two‑component regulatory system with QseB
RA	3,169,196	T→A	25.1%	E57V (GAA→GTA)	yqiA ←	acyl CoA esterase
RA	3,172,251	C→A	25.7%	R260S (CGC→AGC)	tolC →	transport channel
RA	3,173,669	G→T	100%	A189A (GCG→GCT)	ygiB →	DUF1190 family protein
RA	3,176,733	G→T	100%	intergenic (+51/+439)	zupT → / ← ribB	zinc transporter/3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase
RA	3,176,820	G→T	100%	intergenic (+138/+352)	zupT → / ← ribB	zinc transporter/3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase
RA	3,182,647	G→T	100%	pseudogene (1868/2445 nt)	yqiG →	pseudogene; fimbrial export usher family;putative membrane; Not classified; putative membrane protein
RA	3,182,732	T→A	36.4%	pseudogene (1953/2445 nt)	yqiG →	pseudogene; fimbrial export usher family;putative membrane; Not classified; putative membrane protein
RA	3,184,211	C→A	100%	S74Y (TCT→TAT)	yqiI →	fimbrial protein
RA	3,186,181	G→C	57.5%	W205C (TGG→TGC)	yqiJ →	DUF1449 family inner membrane protein
RA	3,189,569	C→A	69.0%	D182Y (GAT→TAT)	hldE ←	fused heptose 7‑phosphate kinase/heptose 1‑phosphate adenyltransferase
RA	3,193,329	G→T	5.8%	G332G (GGC→GGA)	ygiF ←	inorganic triphosphatase
RA	3,199,743	C→A	100%	intergenic (‑128/‑79)	ttdR ← / → ttdA	transcriptional activator of ttdABT/L‑tartrate dehydratase, alpha subunit
RA	3,201,209	C→A	100%	F160L (TTC→TTA)	ttdB →	L‑tartrate dehydratase, beta subunit
RA	3,205,512	A→C	7.5%	L349L (CTA→CTC)	dnaG →	DNA primase
RA	3,212,264	G→T	34.2%	H58N (CAC→AAC)	aer ←	fused signal transducer for aerotaxis sensory component/methyl accepting chemotaxis component
RA	3,217,289	A→T	100%	H433L (CAC→CTC)	ebgA →	evolved beta‑D‑galactosidase, alpha subunit
RA	3,224,927	C→A	100%	intergenic (+329/‑97)	ygjK → / → fadH	alpha‑glucosidase/2,4‑dienoyl‑CoA reductase, NADH and FMN‑linked
RA	3,230,857	C→G	100%	A63G (GCC→GGC)	ygjR →	putative NAD(P)‑dependent dehydrogenase
RA	3,231,349	A→C	100%	Q227P (CAG→CCG)	ygjR →	putative NAD(P)‑dependent dehydrogenase
RA	3,238,152	C→T	8.8%	intergenic (‑52/‑311)	uxaC ← / → exuT	uronate isomerase/hexuronate transporter
RA	3,238,283	C→A	100%	intergenic (‑183/‑180)	uxaC ← / → exuT	uronate isomerase/hexuronate transporter
RA	3,243,768	C→T	100%	intergenic (+33/‑153)	yqjK → / → yqjF	uncharacterized protein/putative quinol oxidase subunit
RA	3,245,848	G→T	100%	L62L (CTG→CTT)	yhaH →	DUF805 family inner membrane protein
RA	3,246,619	Δ1 bp	71.4%	coding (350/357 nt)	yhaI →	DUF805 family inner membrane protein
RA	3,249,474	C→A	58.2%	T179T (ACG→ACT)	yhaM ←	putative L‑serine dehydratase alpha chain
RA	3,252,258	C→A	100%	D251Y (GAT→TAT)	tdcG ←	L‑serine dehydratase 3, anaerobic
RA	3,254,752	C→A	100%	V342V (GTG→GTT)	tdcE ←	pyruvate formate‑lyase 4/2‑ketobutyrate formate‑lyase
RA	3,258,871	G→T	100%	L173I (CTC→ATC)	tdcB ←	L‑threonine dehydratase, catabolic
RA	3,261,001	G→A	100%	intergenic (+44/‑212)	tdcR → / → yhaB	L‑threonine dehydratase operon activator protein/uncharacterized protein
RA	3,263,409	C→T	100%	intergenic (+448/+166)	yhaC → / ← rnpB	pentapetide repeats‑related protein/RNase P, M1 RNA component
RA	3,263,502	C→T	5.8%	intergenic (+541/+73)	yhaC → / ← rnpB	pentapetide repeats‑related protein/RNase P, M1 RNA component
RA	3,266,646	C→A	100%	G91C (GGT→TGT)	garL ←	alpha‑dehydro‑beta‑deoxy‑D‑glucarate aldolase
RA	3,268,357	C→A	100%	intergenic (‑91/‑284)	garP ← / → garD	putative (D)‑galactarate transporter/(D)‑galactarate dehydrogenase
RA	3,271,128	A→C	100%	T145P (ACC→CCC)	yhaV →	toxin of the SohB(PrlF)‑YhaV toxin‑antitoxin system
RA	3,273,402	C→T	10.5%	S377L (TCA→TTA)	kbaZ →	tagatose 6‑phosphate aldolase 1, kbaZ subunit
RA	3,275,210	A→G	100%	intergenic (+226/‑125)	agaA → / → agaS	pseudogene, N‑acetylgalactosamine‑6‑phosphate deacetylase fragment; putative N‑acetylgalactosamine‑6‑phosphate deacetylase/tagatose‑6‑phosphate ketose/aldose isomerase
RA	3,290,634	C→A	5.8%	M288I (ATG→ATT)	yraQ ←	putative inner membrane permease
RA	3,290,970	A→T	100%	R176R (CGT→CGA)	yraQ ←	putative inner membrane permease
RA	3,295,911	C→A	100%	Q22K (CAG→AAG)	yhbV →	U32 peptidase family protein
RA	3,296,612	G→T	100%	A255A (GCG→GCT)	yhbV →	U32 peptidase family protein
RA	3,299,240	A→C	100%	intergenic (‑64/+90)	mtr ← / ← deaD	tryptophan transporter of high affinity/ATP‑dependent RNA helicase
RA	3,302,027	G→T	100%	S86* (TCG→TAG)	nlpI ←	lipoprotein involved in osmotic sensitivity and filamentation
RA	3,306,165	C→A	70.2%	V125F (GTT→TTT)	rbfA ←	30s ribosome binding factor
RA	3,307,024	C→A	23.8%	G784C (GGT→TGT)	infB ←	translation initiation factor IF‑2
RA	3,312,055	C→A	100%	G20G (GGC→GGA)	argG →	argininosuccinate synthetase
RA	3,314,870	C→A	100%	A35S (GCG→TCG)	yhbX ←	putative EptAB family phosphoethanolamine transferase, inner membrane protein
RA	3,317,805	C→A	73.2%	D156Y (GAT→TAT)	folP ←	7,8‑dihydropteroate synthase
RA	3,319,509	A→T	5.0%	A262A (GCT→GCA)	ftsH ←	protease, ATP‑dependent zinc‑metallo
RA	3,332,963	C→A	100%	A154A (GCG→GCT)	mlaF ←	ABC transporter maintaining OM lipid asymmetry, ATP‑binding protein
RA	3,334,464	C→A	100%	S277R (AGC→AGA)	yrbG →	putative calcium/sodium:proton antiporter
RA	3,334,687	G→T	100%	A21A (GCG→GCT)	kdsD →	D‑arabinose 5‑phosphate isomerase
RA	3,334,940	T→G	67.0%	S106A (TCT→GCT)	kdsD →	D‑arabinose 5‑phosphate isomerase
RA	3,340,038	C→A	24.1%	I34I (ATC→ATA)	ptsN →	sugar‑specific enzyme IIA component of PTS
RA	3,343,975	C→A	100%	noncoding (40/121 nt)	arcZ →	sRNA positive antisense regulator of rpoS; binds Hfq
RA	3,345,801	A→T	6.6%	L195Q (CTG→CAG)	arcB ←	aerobic respiration control sensor histidine protein kinase, cognate to two‑component response regulators ArcA and RssB
RA	3,347,644	G→A	7.9%	intergenic (‑235/‑440)	yhcC ← / → gltB	putative Fe‑S oxidoreductase, Radical SAM superfamily protein/glutamate synthase, large subunit
RA	3,347,778	G→A	100%	intergenic (‑369/‑306)	yhcC ← / → gltB	putative Fe‑S oxidoreductase, Radical SAM superfamily protein/glutamate synthase, large subunit
RA	3,350,663	C→A	23.3%	T860T (ACC→ACA)	gltB →	glutamate synthase, large subunit
RA	3,351,650	G→T	100%	E1189D (GAG→GAT)	gltB →	glutamate synthase, large subunit
RA	3,354,405	C→T	100%	intergenic (+430/‑130)	gltD → / → gltF	glutamate synthase, 4Fe‑4S protein, small subunit/periplasmic protein
RA	3,355,202	T→A	6.7%	L223* (TTA→TAA)	gltF →	periplasmic protein
RA	3,365,607	G→T	100%	I109I (ATC→ATA)	nanT ←	sialic acid transporter
RA	3,373,441	A→C	42.8%	intergenic (‑85/‑109)	yhcM ← / → yhcB	putative AFG1‑like family P‑loop ATPase/DUF1043 family inner membrane‑anchored protein
RA	3,373,457	C→A	100%	intergenic (‑101/‑93)	yhcM ← / → yhcB	putative AFG1‑like family P‑loop ATPase/DUF1043 family inner membrane‑anchored protein
RA	3,373,985	C→A	100%	intergenic (+37/‑117)	yhcB → / → degQ	DUF1043 family inner membrane‑anchored protein/serine endoprotease, periplasmic
RA	3,375,260	G→T	100%	D387Y (GAT→TAT)	degQ →	serine endoprotease, periplasmic
RA	3,381,943	C→A	27.7%	T181T (ACG→ACT)	aaeA ←	p‑hydroxybenzoic acid efflux system component
RA	3,384,761	A→C	6.4%	G209G (GGT→GGG)	tldD ←	putative peptidase
RA	3,384,766	A→C	19.8%	F208V (TTT→GTT)	tldD ←	putative peptidase
RA	3,385,516	A→T	7.4%	intergenic (‑129/+301)	tldD ← / ← yhdP	putative peptidase/DUF3971‑AsmA2 domains protein
RA	3,385,662	C→G	6.2%	intergenic (‑275/+155)	tldD ← / ← yhdP	putative peptidase/DUF3971‑AsmA2 domains protein
RA	3,385,696	T→A	5.2%	intergenic (‑309/+121)	tldD ← / ← yhdP	putative peptidase/DUF3971‑AsmA2 domains protein
RA	3,392,594	A→C	8.7%	A248A (GCT→GCG)	mreC ←	cell wall structural complex MreBCD transmembrane component MreC
RA	3,396,082	G→T	100%	R204S (CGT→AGT)	csrD ←	targeting factor for csrBC sRNA degradation
RA	3,402,321	C→A	13.6%	I452I (ATC→ATA)	panF →	pantothenate:sodium symporter
RA	3,403,534	C→T	100%	intergenic (+224/‑105)	prmA → / → dusB	methyltransferase for 50S ribosomal subunit protein L11/tRNA‑dihydrouridine synthase B
RA	3,404,059	C→A	100%	R141S (CGC→AGC)	dusB →	tRNA‑dihydrouridine synthase B
RA	3,407,007	G→A	100%	intergenic (‑183/‑216)	acrS ← / → acrE	acrAB operon transcriptional repressor/cytoplasmic membrane lipoprotein
RA	3,407,969	C→A	100%	N249K (AAC→AAA)	acrE →	cytoplasmic membrane lipoprotein
RA	3,409,856	A→C	100%	T489P (ACC→CCC)	acrF →	multidrug efflux system protein
RA	3,411,250	G→T	100%	E953D (GAG→GAT)	acrF →	multidrug efflux system protein
RA	3,415,112	C→A	10.6%	G143G (GGC→GGA)	yhdY →	putative amino‑acid transporter subunit
RA	3,415,702	T→A	28.4%	L340Q (CTG→CAG)	yhdY →	putative amino‑acid transporter subunit
RA	3,416,666	T→G	7.5%	intergenic (+113/+116)	yhdZ → / ← rrfF	putative amino‑acid transporter subunit/5S ribosomal RNA of rrnD operon
RA	3,416,890	T→G	7.2%	noncoding (12/120 nt)	rrfF ←	5S ribosomal RNA of rrnD operon
RA	3,422,726	G→T	100%	V44V (GTG→GTT)	yrdA →	bacterial transferase hexapeptide domain protein
RA	3,424,363	T→A	100%	T138S (ACC→TCC)	tsaC ←	tRNA(ANN) t(6)A37 threonylcarbamoyladenosine modification protein, threonine‑dependent ADP‑forming ATPase
RA	3,433,098	G→T	23.5%	F87L (TTC→TTA)	rplQ ←	50S ribosomal subunit protein L17
RA	3,440,151	G→T	100%	I31I (ATC→ATA)	rpsN ←	30S ribosomal subunit protein S14
RA	3,440,444	G→T	100%	S118S (TCC→TCA)	rplE ←	50S ribosomal subunit protein L5
RA	3,440,832	T→C	100%	N99D (AAC→GAC)	rplX ←	50S ribosomal subunit protein L24
RA	3,445,410	C→A	100%	R79L (CGT→CTT)	rplD ←	50S ribosomal subunit protein L4
RA	3,448,742	C→A	100%	E6* (GAA→TAA)	gspA ←	general secretory pathway component, cryptic
RA	3,449,105	C→A	5.1%	Q57K (CAG→AAG)	gspC →	general secretory pathway component, cryptic
RA	3,453,433	T→A	17.5%	G86G (GGT→GGA)	gspF →	general secretory pathway component, cryptic
RA	3,455,867	C→A	100%	I55I (ATC→ATA)	gspJ →	putative general secretory pathway component, cryptic
RA	3,455,930	C→A	100%	I76I (ATC→ATA)	gspJ →	putative general secretory pathway component, cryptic
RA	3,459,603	A→T	67.6%	intergenic (+24/+5)	gspO → / ← bfr	bifunctional prepilin leader peptidase/ methylase/bacterioferritin, iron storage and detoxification protein
RA	3,461,433	C→A	9.3%	D594Y (GAC→TAC)	chiA ←	periplasmic endochitinase
RA	3,466,238	A→T	8.0%	V212V (GTT→GTA)	fusA ←	protein chain elongation factor EF‑G, GTP‑binding
RA	3,470,272	C→A	100%	V169V (GTG→GTT)	fkpA ←	FKBP‑type peptidyl‑prolyl cis‑trans isomerase (rotamase)
RA	3,471,705	C→T	100%	G51D (GGT→GAT)	slyD ←	FKBP‑type peptidyl prolyl cis‑trans isomerase (rotamase)
RA	3,473,139	G→T	100%	I276I (ATC→ATA)	kefB ←	potassium:proton antiporter
RA	3,475,255	C→A	100%	S203Y (TCT→TAT)	yheS →	putative transporter subunit of ABC superfamily: ATP‑binding component
RA	3,475,763	G→T	14.5%	A372A (GCG→GCT)	yheS →	putative transporter subunit of ABC superfamily: ATP‑binding component
RA	3,479,769	A→T	100%	E97D (GAA→GAT)	crp →	cAMP‑activated global transcription factor, mediator of catabolite repression
RA	3,487,342	C→T	100%	intergenic (+234/‑28)	tsgA → / → nirB	putative transporter/nitrite reductase, large subunit, NAD(P)H‑binding
RA	3,488,966	G→C	100%	A533P (GCC→CCC)	nirB →	nitrite reductase, large subunit, NAD(P)H‑binding
RA	3,489,397	C→A	100%	F676L (TTC→TTA)	nirB →	nitrite reductase, large subunit, NAD(P)H‑binding
RA	3,493,210	C→T	23.2%	intergenic (+236/‑59)	yhfL → / → frlA	small lipoprotein/putative fructoselysine transporter
RA	3,498,214	T→G	7.3%	intergenic (+72/+80)	frlR → / ← yhfS	putative DNA‑binding transcriptional regulator/FNR‑regulated pyridoxal phosphate‑dependent aminotransferase family protein
RA	3,498,239	A→C	6.0%	intergenic (+97/+55)	frlR → / ← yhfS	putative DNA‑binding transcriptional regulator/FNR‑regulated pyridoxal phosphate‑dependent aminotransferase family protein
RA	3,498,240	A→C	7.9%	intergenic (+98/+54)	frlR → / ← yhfS	putative DNA‑binding transcriptional regulator/FNR‑regulated pyridoxal phosphate‑dependent aminotransferase family protein
RA	3,501,571	C→A	100%	G127C (GGC→TGC)	php ←	phosphotriesterase homology protein
RA	3,504,143	G→T	100%	R65S (CGT→AGT)	yhfX ←	putative pyridoxal 5'‑phosphate binding protein
RA	3,507,749	G→T	100%	H224N (CAT→AAT)	rpe ←	D‑ribulose‑5‑phosphate 3‑epimerase
RA	3,509,102	G→T	100%	S57R (AGC→AGA)	dam ←	DNA adenine methyltransferase
RA	3,512,321	A→T	10.8%	S35T (TCC→ACC)	aroK ←	shikimate kinase I
RA	3,513,424	A→T	100%	V213V (GTT→GTA)	hofQ ←	DNA catabolic putative fimbrial transporter
RA	3,518,052	C→A	26.3%	P608Q (CCG→CAG)	mrcA →	fused penicillin‑binding protein 1a: murein transglycosylase/murein transpeptidase
RA	3,519,188	C→A	100%	L107L (CTG→CTT)	nudE ←	adenosine nucleotide hydrolase; substrates include Ap3A, Ap2A, ADP‑ribose, NADH
RA	3,519,657	G→T	100%	intergenic (‑149/‑171)	nudE ← / → yrfF	adenosine nucleotide hydrolase; substrates include Ap3A, Ap2A, ADP‑ribose, NADH/inner membrane protein
RA	3,528,406	G→T	100%	I274I (ATC→ATA)	envZ ←	sensory histidine kinase in two‑component regulatory system with OmpR
RA	3,535,370	C→A	100%	S535R (AGC→AGA)	feoB →	fused ferrous iron transporter, protein B: GTP‑binding protein/membrane protein
RA	3,538,583	C→A	29.7%	R115S (CGC→AGC)	gntX →	DNA catabolic protein
RA	3,543,793	G→T	9.2%	T680T (ACC→ACA)	malP ←	maltodextrin phosphorylase
RA	3,543,959	G→T	100%	A625E (GCG→GAG)	malP ←	maltodextrin phosphorylase
RA	3,545,077	C→A	29.1%	L252L (CTG→CTT)	malP ←	maltodextrin phosphorylase
JC	3,547,418	Δ28 bp	9.9%	coding (975‑1002/2706 nt)	malT →	mal regulon transcriptional activator
RA	3,547,635	A→T	5.7%	K398* (AAG→TAG)	malT →	mal regulon transcriptional activator
RA	3,549,090	C→A	49.3%	R883S (CGC→AGC)	malT →	mal regulon transcriptional activator
RA	3,561,574	C→A	100%	W372L (TGG→TTG)	glgC ←	glucose‑1‑phosphate adenylyltransferase
RA	3,565,147	A→T	10.1%	F572L (TTT→TTA)	glgB ←	1,4‑alpha‑glucan branching enzyme
RA	3,566,100	G→T	25.5%	R255S (CGC→AGC)	glgB ←	1,4‑alpha‑glucan branching enzyme
RA	3,567,059	C→A	100%	intergenic (‑197/+76)	glgB ← / ← asd	1,4‑alpha‑glucan branching enzyme/aspartate‑semialdehyde dehydrogenase, NAD(P)‑binding
RA	3,571,015	C→T	10.4%	intergenic (‑63/+76)	gntK ← / ← gntR	gluconate kinase 2/d‑gluconate inducible gluconate regulon transcriptional repressor
RA	3,571,153	C→A	100%	E312* (GAA→TAA)	gntR ←	d‑gluconate inducible gluconate regulon transcriptional repressor
RA	3,575,032	C→A	100%	intergenic (+46/‑191)	yhhY → / → yhhZ	putative acetyltransferase/putative Hcp1 family polymorphic toxin protein; putative colicin‑like DNase/tRNase activity
RA	3,576,745	G→T	20.4%	pseudogene (348/381 nt)	yrhA →	pseudogene, interrupted by IS1E
RA	3,577,827	A→G	28.0%	intergenic (+158/‑292)	yrhA → / → yrhB	pseudogene, interrupted by IS1E/stable heat shock chaperone
RA	3,582,807	G→T	100%	P194Q (CCG→CAG)	ugpE ←	glycerol‑3‑phosphate transporter subunit
RA	3,590,636	G→T	100%	Y95* (TAC→TAA)	livK ←	leucine transporter subunit
RA	3,590,906	C→A	100%	A5A (GCG→GCT)	livK ←	leucine transporter subunit
RA	3,591,957	T→G	100%	V354V (GTA→GTC)	livJ ←	leucine/isoleucine/valine transporter subunit
RA	3,594,268	C→T	100%	intergenic (‑125/+120)	rpoH ← / ← ftsX	RNA polymerase, sigma 32 (sigma H) factor/inner membrane putative ABC superfamily transporter permease
RA	3,596,266	C→A	100%	T446T (ACG→ACT)	ftsY ←	Signal Recognition Particle (SRP) receptor
RA	3,598,440	C→A	100%	N34K (AAC→AAA)	yhhL →	DUF1145 family protein
RA	3,601,909	C→A	60.6%	T700K (ACG→AAG)	zntA →	zinc, cobalt and lead efflux system
RA	3,602,081	A→C	7.3%	intergenic (+72/+30)	zntA → / ← tusA	zinc, cobalt and lead efflux system/mnm(5)‑s(2)U34‑tRNA 2‑thiolation sulfurtransferase
RA	3,604,608	C→A	28.1%	A162A (GCG→GCT)	yhhS ←	putative arabinose efflux transporter
RA	3,607,110	C→A	100%	I28I (ATC→ATA)	nikA →	nickel‑binding, heme‑binding periplasmic protein
RA	3,612,284	G→T	100%	D113Y (GAT→TAT)	nikR →	transcriptional repressor, Ni‑binding
RA	3,618,536	C→A	100%	R267R (CGG→AGG)	yhhI →	putative transposase
RA	3,622,058	C→A	100%	D281Y (GAT→TAT)	rbbA ←	ribosome‑associated ATPase: ATP‑binding protein/ATP‑binding membrane protein
RA	3,629,424	T→A	100%	intergenic (+171/+144)	yhiM → / ← yhiN	acid resistance protein, inner membrane/putative oxidoreductase
RA	3,630,577	T→A	13.1%	Q65L (CAG→CTG)	yhiN ←	putative oxidoreductase
RA	3,634,060	A→G	6.7%	intergenic (+155/‑162)	uspA → / → dtpB	universal stress global response regulator/dipeptide and tripeptide permease B
RA	3,637,274	C→A	13.4%	M423I (ATG→ATT)	prlC ←	oligopeptidase A
RA	3,638,641	C→A	100%	intergenic (‑99/‑104)	prlC ← / → rlmJ	oligopeptidase A/23S rRNA m(6)A2030 methyltransferase, SAM‑dependent
RA	3,639,239	G→T	100%	P165P (CCG→CCT)	rlmJ →	23S rRNA m(6)A2030 methyltransferase, SAM‑dependent
RA	3,644,531	G→A	100%	intergenic (+509/‑120)	arsC → / → yhiS	arsenate reductase/pseudogene
RA	3,646,984	G→T	100%	pseudogene (394/483 nt)	yhiS →	pseudogene
RA	3,649,460	T→A	60.5%	K65* (AAA→TAA)	hdeB ←	acid‑resistance protein
RA	3,649,797	C→A	100%	E102* (GAA→TAA)	hdeA ←	stress response protein acid‑resistance protein
RA	3,657,375	G→A	100%	P202S (CCT→TCT)	gadW ←	transcriptional activator of gadA and gadBC; repressor of gadX
RA	3,659,083	T→A	63.9%	N30Y (AAT→TAT)	gadX ←	acid resistance regulon transcriptional activator; autoactivator
RA	3,661,610	A→T	100%	F313L (TTT→TTA)	yhjA ←	putative cytochrome C peroxidase
RA	3,662,660	T→C	100%	intergenic (‑112/‑292)	yhjA ← / → treF	putative cytochrome C peroxidase/cytoplasmic trehalase
RA	3,664,901	C→A	11.2%	A118A (GCG→GCT)	yhjB ←	putative DNA‑binding transcriptional response regulator
RA	3,665,383	G→T	19.6%	intergenic (‑129/‑391)	yhjB ← / → yhjC	putative DNA‑binding transcriptional response regulator/LysR family putative transcriptional regulator
RA	3,667,555	C→A	69.8%	I278I (ATC→ATA)	yhjD →	inner membrane putative BrbK family alternate lipid exporter
RA	3,667,959	C→A	100%	intergenic (+224/‑187)	yhjD → / → yhjE	inner membrane putative BrbK family alternate lipid exporter/MFS superfamily sugar transport 1 family protein
RA	3,674,442	G→T	12.6%	R287S (CGT→AGT)	yhjJ ←	putative periplasmic M16 family chaperone
RA	3,674,730	C→A	23.9%	D191Y (GAT→TAT)	yhjJ ←	putative periplasmic M16 family chaperone
RA	3,676,851	G→A	7.1%	intergenic (‑44/+139)	dctA ← / ← yhjK	C4‑dicarboxylic acid, orotate and citrate transporter/cyclic‑di‑GMP phosphodiesterase
RA	3,679,301	T→G	100%	Q1078P (CAG→CCG)	bcsC ←	cellulose synthase subunit
RA	3,679,324	C→A	100%	M1070I (ATG→ATT)	bcsC ←	cellulose synthase subunit
RA	3,679,463	T→A	9.0%	Y1024F (TAC→TTC)	bcsC ←	cellulose synthase subunit
RA	3,680,910	G→T	100%	H542N (CAT→AAT)	bcsC ←	cellulose synthase subunit
RA	3,686,345	C→A	100%	R751L (CGC→CTC)	bcsA ←	cellulose synthase, catalytic subunit
RA	3,692,994	T→A	100%	F474Y (TTC→TAC)	bcsG →	DUF3260 family inner membrane protein associated with cellulose production
RA	3,693,083	G→T	70.3%	V504F (GTT→TTT)	bcsG →	DUF3260 family inner membrane protein associated with cellulose production
RA	3,698,119	C→A	100%	M1M (ATG→ATT) †	dppC ←	dipeptide/heme transporter
RA	3,698,875	G→T	100%	F92L (TTC→TTA)	dppB ←	dipeptide/heme transporter
RA	3,711,448	T→A	6.4%	L260Q (CTG→CAG)	ghrB →	glyoxylate/hydroxypyruvate reductase B
RA	3,717,788	C→A	100%	P297P (CCG→CCT)	glyQ ←	glycine tRNA synthetase, alpha subunit
RA	3,721,485	T→G	7.3%	Y416S (TAC→TCC)	xylB ←	xylulokinase
RA	3,722,763	C→A	19.3%	intergenic (‑32/+40)	xylB ← / ← xylA	xylulokinase/D‑xylose isomerase
RA	3,723,822	C→A	8.3%	D102Y (GAT→TAT)	xylA ←	D‑xylose isomerase
RA	3,727,580	C→A	100%	A167A (GCC→GCA)	xylH →	D‑xylose ABC transporter permease subunit
RA	3,729,221	C→A	25.9%	R295S (CGT→AGT)	xylR →	xylose divergent operon transcriptional activator
RA	3,729,325	C→A	18.8%	T329T (ACC→ACA)	xylR →	xylose divergent operon transcriptional activator
RA	3,732,549	G→T	26.1%	D565Y (GAT→TAT)	malS →	alpha‑amylase
RA	3,735,263	C→A	6.4%	A210A (GCG→GCT)	yiaJ ←	transcriptional repressor of yiaK‑S operon
RA	3,736,722	C→A	100%	G210G (GGC→GGA)	yiaK →	2,3‑diketo‑L‑gulonate reductase, NADH‑dependent
RA	3,738,088	T→A	26.6%	F134Y (TTC→TAC)	yiaM →	2,3‑diketo‑L‑gulonate TRAP transporter small permease protein
RA	3,738,431	C→A	100%	P90T (CCA→ACA)	yiaN →	2,3‑diketo‑L‑gulonate TRAP transporter large permease protein
RA	3,751,135	G→T	67.3%	S18* (TCA→TAA)	yiaY ←	putative Fe‑containing alcohol dehydrogenase, Pfam00465 family
RA	3,751,360	C→T	18.1%	intergenic (‑173/+17)	yiaY ← / ← selB	putative Fe‑containing alcohol dehydrogenase, Pfam00465 family/selenocysteinyl‑tRNA‑specific translation factor
RA	3,755,723	G→T	78.3%	E61* (GAA→TAA)	rhsA →	Rhs family protein, putative polymorphic toxin; putative polysaccharide synthesis/export protein; putative neighboring cell growth inhibitor
RA	3,767,000	G→T	100%	D454Y (GAC→TAC)	mtlA →	fused mannitol‑specific PTS enzymes: IIA components/IIB components/IIC components
RA	3,767,085	T→A	5.9%	L482Q (CTG→CAG)	mtlA →	fused mannitol‑specific PTS enzymes: IIA components/IIB components/IIC components
RA	3,767,242	G→T	6.4%	A534A (GCG→GCT)	mtlA →	fused mannitol‑specific PTS enzymes: IIA components/IIB components/IIC components
RA	3,767,410	G→T	100%	V590V (GTG→GTT)	mtlA →	fused mannitol‑specific PTS enzymes: IIA components/IIB components/IIC components
RA	3,772,732	G→T	26.5%	A107S (GCC→TCC)	lldR →	dual role activator/repressor for lldPRD operon
RA	3,779,281	C→G	5.8%	A221G (GCT→GGT)	gpmM →	phosphoglycero mutase III, cofactor‑independent
RA	3,779,319	G→T	7.5%	E234* (GAA→TAA)	gpmM →	phosphoglycero mutase III, cofactor‑independent
RA	3,780,573	C→A	28.0%	R126S (CGT→AGT)	envC →	activator of AmiB,C murein hydrolases, septal ring factor
RA	3,782,439	G→T	27.4%	R335S (CGC→AGC)	waaH ←	LPS(HepIII)‑glucuronic acid glycosyltransferase
RA	3,783,727	C→A	25.9%	A327S (GCT→TCT)	tdh ←	L‑threonine 3‑dehydrogenase, NAD(P)‑binding
RA	3,783,857	A→T	56.3%	I283I (ATT→ATA)	tdh ←	L‑threonine 3‑dehydrogenase, NAD(P)‑binding
RA	3,784,878	A→T	20.6%	L345Q (CTG→CAG)	kbl ←	glycine C‑acetyltransferase
RA	3,785,915	G→T	100%	intergenic (‑4/+271)	kbl ← / ← yibB	glycine C‑acetyltransferase/YibB family protein, function unknown
RA	3,786,687	C→A	6.5%	L119F (TTG→TTT)	yibB ←	YibB family protein, function unknown
RA	3,789,229	T→A	12.2%	V314E (GTG→GAG)	waaF →	ADP‑heptose:LPS heptosyltransferase II
RA	3,789,381	C→A	100%	L15I (CTC→ATC)	waaC →	ADP‑heptose:LPS heptosyl transferase I
RA	3,798,582	C→A	20.6%	Q243H (CAG→CAT)	waaP ←	kinase that phosphorylates core heptose of lipopolysaccharide
RA	3,805,743	T→A	6.5%	L59F (TTA→TTT)	yicR ←	UPF0758 family protein
RA	3,810,195	C→A	100%	R54S (CGT→AGT)	yicC →	UPF0701 family protein
RA	3,816,601	A→T	100%	H281L (CAC→CTC)	spoT →	bifunctional (p)ppGpp synthetase II/ guanosine‑3',5'‑bis pyrophosphate 3'‑pyrophosphohydrolase
RA	3,817,604	G→T	27.5%	V615V (GTG→GTT)	spoT →	bifunctional (p)ppGpp synthetase II/ guanosine‑3',5'‑bis pyrophosphate 3'‑pyrophosphohydrolase
RA	3,818,010	C→A	100%	H46N (CAT→AAT)	trmH →	tRNA mG18‑2'‑O‑methyltransferase, SAM‑dependent
RA	3,822,339	A→C	6.6%	Q12P (CAA→CCA) ‡	xanP →	xanthine permease
RA	3,822,340	A→C	16.5%	Q12H (CAA→CAC) ‡	xanP →	xanthine permease
RA	3,824,948	T→A	29.3%	W378R (TGG→AGG)	yicH →	putative inner membrane‑anchored periplasmic AsmA family protein
RA	3,825,702	C→A	100%	K732N (AAG→AAT)	yicI ←	putative alpha‑glucosidase
RA	3,826,247	A→T	65.4%	Y551N (TAC→AAC)	yicI ←	putative alpha‑glucosidase
RA	3,828,206	T→A	100%	S362C (AGT→TGT)	yicJ ←	putative transporter
RA	3,830,197	C→A	100%	intergenic (+281/‑116)	yicT → / → setC	pseudogene/putative arabinose efflux transporter
RA	3,830,311	G→T	100%	intergenic (+395/‑2)	yicT → / → setC	pseudogene/putative arabinose efflux transporter
RA	3,830,819	T→G	100%	F169L (TTT→TTG)	setC →	putative arabinose efflux transporter
RA	3,832,140	C→A	12.2%	T178K (ACG→AAG)	yicL →	EamA family inner membrane putative transporter
RA	3,832,308	G→C	24.3%	S234T (AGT→ACT)	yicL →	EamA family inner membrane putative transporter
RA	3,833,664	C→A	58.7%	S30S (TCC→TCA)	yicS →	putative periplasmic protein
RA	3,837,532	C→A	68.0%	P70Q (CCG→CAG)	ade →	cryptic adenine deaminase
RA	3,839,798	C→A	100%	D244Y (GAT→TAT)	uhpT ←	hexose phosphate transporter
JC	3,841,409	+CAACCAG	100%	coding (576/1320 nt)	uhpC ←	membrane protein regulates uhpT expression
RA	3,842,467	C→A	28.6%	G344W (GGG→TGG)	uhpB ←	sensory histidine kinase in two‑component regulatory sytem with UhpA
RA	3,846,672	T→C	8.0%	intergenic (‑55/‑241)	istR ← / → tisB	sRNA antisense regulators IstR‑1 and IstR‑2, affectr tisB, Hfq‑dependent/toxic membrane persister formation peptide, LexA‑regulated
RA	3,859,476	G→T	5.8%	T53K (ACA→AAA)	yidE ←	putative transporter
RA	3,860,159	C→A	100%	P33P (CCG→CCT)	ibpB ←	heat shock chaperone
RA	3,860,327	C→A	100%	intergenic (‑70/+42)	ibpB ← / ← ibpA	heat shock chaperone/heat shock chaperone
RA	3,860,653	C→A	100%	E44* (GAA→TAA)	ibpA ←	heat shock chaperone
RA	3,861,553	C→A	100%	G373C (GGC→TGC)	yidR ←	DUF3748 family protein
RA	3,863,438	G→T	100%	M234I (ATG→ATT)	cbrA →	colicin M resistance protein; FAD‑binding protein, putative oxidoreductase
RA	3,865,120	C→A	100%	intergenic (‑30/+90)	dgoT ← / ← dgoD	D‑galactonate transporter/galactonate dehydratase
RA	3,865,863	T→A	100%	T166S (ACC→TCC)	dgoD ←	galactonate dehydratase
RA	3,870,977	T→A	5.4%	intergenic (‑152/+88)	yidB ← / ← gyrB	DUF937 family protein/DNA gyrase, subunit B
RA	3,871,008	G→T	13.8%	intergenic (‑183/+57)	yidB ← / ← gyrB	DUF937 family protein/DNA gyrase, subunit B
RA	3,871,587	G→T	28.2%	N631K (AAC→AAA)	gyrB ←	DNA gyrase, subunit B
RA	3,872,006	T→A	100%	S492C (AGC→TGC)	gyrB ←	DNA gyrase, subunit B
RA	3,873,695	C→A	56.9%	R296L (CGG→CTG)	recF ←	gap repair protein
RA	3,875,148	C→A	29.4%	A178A (GCG→GCT)	dnaN ←	DNA polymerase III, beta subunit
RA	3,875,671	G→A	28.0%	T4I (ACC→ATC)	dnaN ←	DNA polymerase III, beta subunit
RA	3,877,722	A→T	7.8%	V9V (GTA→GTT)	rpmH →	50S ribosomal subunit protein L34
RA	3,880,731	G→T	100%	D182Y (GAT→TAT)	mnmE →	tRNA U34 5‑methylaminomethyl‑2‑thiouridine modification GTPase
RA	3,882,377	C→A	56.4%	T96T (ACC→ACA)	tnaA →	tryptophanase/L‑cysteine desulfhydrase, PLP‑dependent
RA	3,886,162	T→G	8.6%	L13R (CTG→CGG)	yidZ →	putative DNA‑binding transcriptional regulator
RA	3,888,274	C→A	69.5%	P88Q (CCG→CAG)	chrR →	chromate reductase, Class I, flavoprotein
RA	3,890,808	A→T	29.6%	intergenic (+9/‑58)	yieH → / → cbrB	phosphoenolpyruvate and 6‑phosphogluconate phosphatase/PRK09823 family inner membrane protein, creBC regulon
RA	3,890,960	T→A	100%	F32Y (TTC→TAC)	cbrB →	PRK09823 family inner membrane protein, creBC regulon
RA	3,891,618	A→T	12.5%	I79I (ATA→ATT)	cbrC →	UPF0167 family protein
RA	3,892,304	C→A	100%	P150P (CCG→CCT)	yieK ←	putative 6‑phosphogluconolactonase
RA	3,895,987	T→G	18.1%	I359L (ATT→CTT)	bglB ←	cryptic phospho‑beta‑glucosidase B
RA	3,901,415	C→A	100%	P104P (CCG→CCT)	pstB ←	phosphate transporter subunit
RA	3,901,867	T→G	6.2%	intergenic (‑141/+42)	pstB ← / ← pstA	phosphate transporter subunit/phosphate transporter subunit
RA	3,902,074	C→A	5.0%	M242I (ATG→ATT)	pstA ←	phosphate transporter subunit
RA	3,904,553	T→A	100%	P111P (CCA→CCT)	pstS ←	periplasmic phosphate binding protein, high‑affinity
RA	3,904,977	A→T	56.6%	intergenic (‑92/+222)	pstS ← / ← glmS	periplasmic phosphate binding protein, high‑affinity/L‑glutamine:D‑fructose‑6‑phosphate aminotransferase
RA	3,906,384	G→T	100%	I215I (ATC→ATA)	glmS ←	L‑glutamine:D‑fructose‑6‑phosphate aminotransferase
RA	3,906,459	G→T	5.9%	I190I (ATC→ATA)	glmS ←	L‑glutamine:D‑fructose‑6‑phosphate aminotransferase
RA	3,910,416	C→A	100%	R107L (CGT→CTT)	atpD ←	F1 sector of membrane‑bound ATP synthase, beta subunit
RA	3,910,448	G→T	100%	V96V (GTC→GTA)	atpD ←	F1 sector of membrane‑bound ATP synthase, beta subunit
RA	3,910,894	C→A	100%	M244I (ATG→ATT)	atpG ←	F1 sector of membrane‑bound ATP synthase, gamma subunit
RA	3,916,830	C→A	100%	D71Y (GAT→TAT)	rsmG ←	16S rRNA m(7)G527 methyltransferase, SAM‑dependent; glucose‑inhibited cell‑division protein
RA	3,917,554	C→A	100%	L480L (CTG→CTT)	mnmG ←	5‑methylaminomethyl‑2‑thiouridine modification at tRNA U34
RA	3,922,770	C→A	12.3%	R65L (CGA→CTA)	viaA ←	stimulator of RavA ATPase activity; von Willebrand factor domain protein
RA	3,923,028	C→A	100%	D476Y (GAC→TAC)	ravA ←	hexameric AAA+ MoxR family ATPase, putative molecular chaperone
RA	3,925,821	G→T	24.1%	S382S (TCG→TCT)	kup →	potassium transporter
RA	3,926,831	G→T	100%	D41Y (GAT→TAT)	rbsD →	putative cytoplasmic sugar‑binding protein
RA	3,927,972	G→T	100%	E279* (GAA→TAA)	rbsA →	fused D‑ribose transporter subunits of ABC superfamily: ATP‑binding components
RA	3,928,761	G→T	22.0%	P38P (CCG→CCT)	rbsC →	D‑ribose transporter subunit
RA	3,931,021	C→A	100%	A123E (GCG→GAG)	rbsK →	ribokinase
RA	3,931,898	G→T	6.1%	M104I (ATG→ATT)	rbsR →	transcriptional repressor of ribose metabolism
RA	3,932,241	G→T	7.0%	D219Y (GAT→TAT)	rbsR →	transcriptional repressor of ribose metabolism
RA	3,935,100	G→T	100%	intergenic (‑413/‑68)	yieP ← / → rrsC	putative transcriptional regulator/16S ribosomal RNA of rrnC operon
RA	3,936,831	C→A	100%	noncoding (37/76 nt)	gltU →	tRNA‑Glu
RA	3,936,834	G→T	20.8%	noncoding (40/76 nt)	gltU →	tRNA‑Glu
RA	3,945,181	G→T	100%	pseudogene (280/663 nt)	ilvG →	pseudogene, acetolactate synthase 2 large subunit, valine‑insensitive; acetolactate synthase II, large subunit, cryptic, interrupted
RA	3,946,256	A→T	7.8%	Q138L (CAG→CTG)	ilvE →	branched‑chain amino‑acid aminotransferase
RA	3,952,817	T→G	12.6%	intergenic (+12/+75)	ilvC → / ← ppiC	ketol‑acid reductoisomerase, NAD(P)‑binding/peptidyl‑prolyl cis‑trans isomerase C (rotamase C)
RA	3,952,842	A→C	10.2%	intergenic (+37/+50)	ilvC → / ← ppiC	ketol‑acid reductoisomerase, NAD(P)‑binding/peptidyl‑prolyl cis‑trans isomerase C (rotamase C)
RA	3,952,861	T→A	14.0%	intergenic (+56/+31)	ilvC → / ← ppiC	ketol‑acid reductoisomerase, NAD(P)‑binding/peptidyl‑prolyl cis‑trans isomerase C (rotamase C)
RA	3,954,364	G→T	57.3%	D110Y (GAT→TAT)	rep →	DNA helicase and single‑stranded DNA‑dependent ATPase
RA	3,959,351	G→T	100%	P77P (CCG→CCT)	trxA →	thioredoxin 1
RA	3,960,036	G→A	100%	R87H (CGC→CAC)	rho →	transcription termination factor
RA	3,966,854	C→A	100%	R325S (CGT→AGT)	rffG →	dTDP‑glucose 4,6‑dehydratase
RA	3,967,387	G→T	6.9%	P140P (CCG→CCT)	rffH →	glucose‑1‑phosphate thymidylyltransferase
RA	3,967,474	G→T	100%	A169A (GCG→GCT)	rffH →	glucose‑1‑phosphate thymidylyltransferase
RA	3,967,504	A→C	8.0%	K179N (AAA→AAC)	rffH →	glucose‑1‑phosphate thymidylyltransferase
RA	3,968,414	G→T	5.0%	A196A (GCG→GCT)	wecD →	TDP‑fucosamine acetyltransferase
RA	3,969,710	G→T	100%	G25C (GGT→TGT)	wzxE →	O‑antigen translocase
RA	3,972,296	G→T	100%	E112D (GAG→GAT)	wzyE →	putative ECA polysaccharide chain elongation protein
RA	3,973,393	C→A	8.0%	A26A (GCC→GCA)	wecG →	UDP‑N‑acetyl‑D‑mannosaminuronic acid transferase
RA	3,983,298	G→T	29.9%	R277S (CGC→AGC)	hemC ←	hydroxymethylbilane synthase
RA	3,988,075	T→A	100%	V65E (GTG→GAG)	yifL →	putative lipoprotein
RA	3,990,354	C→A	6.3%	H236Q (CAC→CAA)	xerC →	site‑specific tyrosine recombinase
RA	3,993,534	A→G	27.8%	intergenic (+29/+118)	uvrD → / ← yigE	DNA‑dependent ATPase I and helicase II/DUF2233 family protein
RA	3,993,566	A→G	15.0%	intergenic (+61/+86)	uvrD → / ← yigE	DNA‑dependent ATPase I and helicase II/DUF2233 family protein
RA	3,994,076	A→T	100%	L114* (TTA→TAA)	yigE ←	DUF2233 family protein
RA	3,994,247	A→T	100%	V57E (GTG→GAG)	yigE ←	DUF2233 family protein
RA	3,996,346	T→A	100%	I70F (ATC→TTC)	yigG ←	PRK11371 family inner membrane protein
RA	4,001,612	G→T	6.1%	V166F (GTC→TTC)	rhtC →	threonine efflux pump
RA	4,008,459	C→A	9.5%	P683T (CCA→ACA)	metE →	5‑methyltetrahydropteroyltriglutamate‑ homocysteine S‑methyltransferase
RA	4,009,705	G→A	100%	intergenic (‑176/‑86)	ysgA ← / → udp	putative carboxymethylenebutenolidase/uridine phosphorylase
RA	4,012,953	C→A	58.8%	R247S (CGT→AGT)	ubiE →	bifunctional 2‑octaprenyl‑6‑methoxy‑1,4‑benzoquinone methylase/ S‑adenosylmethionine:2‑DMK methyltransferase
RA	4,020,049	C→G	28.8%	P55A (CCG→GCG)	fre →	NAD(P)H‑flavin reductase
RA	4,020,520	G→T	5.4%	D212Y (GAT→TAT)	fre →	NAD(P)H‑flavin reductase
RA	4,024,827	G→T	100%	D103Y (GAT→TAT)	pepQ →	proline dipeptidase
RA	4,034,118	G→T	31.2%	intergenic (+122/+148)	rrfA → / ← mobB	5S ribosomal RNA of rrnA operon/molybdopterin‑guanine dinucleotide biosynthesis protein B
RA	4,035,421	G→T	100%	intergenic (‑62/‑8)	mobA ← / → yihD	molybdopterin‑guanine dinucleotide synthase/DUF1040 protein YihD
RA	4,036,012	G→T	27.4%	D80Y (GAT→TAT)	srkA →	stress response kinase A; MazF antagonist; Thr/Ser kinase involved in Cpx stress response
RA	4,037,484	T→A	100%	intergenic (+80/‑75)	dsbA → / → yihF	periplasmic protein disulfide isomerase I/DUF945 family protein
RA	4,040,044	A→C	33.2%	intergenic (‑82/‑282)	yihG ← / → polA	inner membrane protein, inner membrane acyltransferase/fused DNA polymerase I 5'‑>3' polymerase/3'‑>5' exonuclease/5'‑>3' exonuclease
RA	4,045,302	G→T	100%	intergenic (+86/‑103)	yihI → / → hemN	activator of Der GTPase/coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent
RA	4,045,386	G→T	26.3%	intergenic (+170/‑19)	yihI → / → hemN	activator of Der GTPase/coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent
RA	4,046,172	A→T	100%	K256N (AAA→AAT)	hemN →	coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent
RA	4,053,774	G→T	28.4%	intergenic (+184/‑33)	typA → / → yihL	GTP‑binding protein/putative DNA‑binding transcriptional regulator
RA	4,056,018	T→A	100%	F138I (TTC→ATC)	yihN →	MFS transporter family protein
RA	4,058,809	G→T	100%	I106I (ATC→ATA)	yihO ←	putative transporter
RA	4,062,424	G→T	100%	I71I (ATC→ATA)	yihQ ←	alpha‑glucosidase
RA	4,063,127	T→A	15.6%	N212I (AAT→ATT)	yihR ←	mutarotase superfamily protein, YihR family
RA	4,066,133	T→G	100%	S267R (AGC→CGC)	yihU ←	gamma‑hydroxybutyrate dehydrogenase, NADH‑dependent
RA	4,068,208	C→A	100%	G60G (GGC→GGA)	yihW →	DeoR family putative transcriptional regulator
RA	4,070,543	G→T	100%	D57Y (GAT→TAT)	dtd →	D‑tyr‑tRNA(Tyr) deacylase
RA	4,074,579	G→T	100%	R4S (CGC→AGC)	fdhE ←	formate dehydrogenase formation protein
RA	4,075,234	C→A	100%	D296Y (GAC→TAC)	fdoH ←	formate dehydrogenase‑O, Fe‑S subunit
RA	4,080,364	G→T	8.5%	M1M (ATG→ATT) †	yiiG →	DUF3829 family lipoprotein
RA	4,088,850	C→A	100%	R93S (CGT→AGT)	rhaR →	transcriptional activator of rhaSR
RA	4,094,362	C→A	100%	W181L (TGG→TTG)	cpxA ←	sensory histidine kinase in two‑component regulatory system with CpxR
RA	4,097,822	G→T	100%	E115* (GAA→TAA)	pfkA →	6‑phosphofructokinase I
RA	4,108,175	C→T	100%	intergenic (‑157/‑268)	glpF ← / → zapB	glycerol facilitator/FtsZ stabilizer; septal ring assembly factor, stimulates cell division
RA	4,112,864	T→G	7.9%	Q135P (CAG→CCG)	ftsN ←	essential cell division protein
RA	4,117,673	G→T	11.0%	T50T (ACC→ACA)	yiiX ←	putative lipid binding hydrolase, DUF830 family protein
RA	4,122,248	A→T	100%	intergenic (+53/‑296)	metL → / → metF	Bifunctional aspartokinase/homoserine dehydrogenase 2/5,10‑methylenetetrahydrofolate reductase
RA	4,124,384	C→A	100%	H208N (CAT→AAT)	katG →	catalase‑peroxidase HPI, heme b‑containing
RA	4,125,407	C→A	100%	H549N (CAT→AAT)	katG →	catalase‑peroxidase HPI, heme b‑containing
RA	4,127,022	T→G	100%	E188D (GAA→GAC)	yijF ←	DUF1287 family protein
RA	4,135,168	G→T	100%	V416L (GTA→TTA)	pflD →	putative glycine radical domain‑containing pyruvate formate‑lyase
RA	4,150,054	G→T	100%	S222Y (TCT→TAT)	sthA ←	pyridine nucleotide transhydrogenase, soluble
RA	4,150,645	A→T	7.1%	L25Q (CTG→CAG)	sthA ←	pyridine nucleotide transhydrogenase, soluble
RA	4,154,402	A→T	68.6%	E279V (GAA→GTA)	btuB →	vitamin B12/cobalamin outer membrane transporter
RA	4,158,143	A→T	36.2%	intergenic (+15/‑157)	rrsB → / → gltT	16S ribosomal RNA of rrnB operon/tRNA‑Glu
RA	4,158,149	T→C	36.7%	intergenic (+21/‑151)	rrsB → / → gltT	16S ribosomal RNA of rrnB operon/tRNA‑Glu
RA	4,158,400	G→A	18.8%	intergenic (+25/‑169)	gltT → / → rrlB	tRNA‑Glu/23S ribosomal RNA of rrnB operon
RA	4,158,403	G→T	18.4%	intergenic (+28/‑166)	gltT → / → rrlB	tRNA‑Glu/23S ribosomal RNA of rrnB operon
RA	4,158,404	A→G	18.3%	intergenic (+29/‑165)	gltT → / → rrlB	tRNA‑Glu/23S ribosomal RNA of rrnB operon
RA	4,161,564	T→G	29.9%	intergenic (+92/‑1)	rrlB → / → rrfB	23S ribosomal RNA of rrnB operon/5S ribosomal RNA of rrnB operon
RA	4,163,117	T→A	69.7%	I36I (ATT→ATA)	birA →	bifunctional biotin‑[acetylCoA carboxylase] holoenzyme synthetase/ DNA‑binding transcriptional repressor, bio‑5'‑AMP‑binding
RA	4,172,507	C→A	100%	I445I (ATC→ATA)	rpoB →	RNA polymerase, beta subunit
RA	4,173,145	A→T	100%	Q658L (CAG→CTG)	rpoB →	RNA polymerase, beta subunit
RA	4,173,179	G→T	100%	P669P (CCG→CCT)	rpoB →	RNA polymerase, beta subunit
RA	4,176,823	G→T	100%	D516Y (GAC→TAC)	rpoC →	RNA polymerase, beta prime subunit
RA	4,178,969	G→T	100%	R1231L (CGT→CTT)	rpoC →	RNA polymerase, beta prime subunit
RA	4,184,471	A→T	73.5%	I519I (ATT→ATA)	thiC ←	phosphomethylpyrimidine synthase
RA	4,185,155	G→T	25.5%	I291I (ATC→ATA)	thiC ←	phosphomethylpyrimidine synthase
RA	4,190,061	T→A	68.4%	intergenic (+39/‑148)	yjaG → / → hupA	DUF416 domain protein/HU, DNA‑binding transcriptional regulator, alpha subunit
RA	4,193,578	G→T	100%	D111Y (GAT→TAT)	zraR →	fused DNA‑binding response regulator in two‑component regulatory system with ZraS: response regulator/sigma54 interaction protein
RA	4,207,552	G→T	100%	M172I (ATG→ATT)	aceA →	isocitrate lyase
RA	4,210,753	C→A	100%	E555* (GAA→TAA)	arpA ←	ankyrin repeat protein
RA	4,211,576	G→T	100%	S280R (AGC→AGA)	arpA ←	ankyrin repeat protein
RA	4,211,803	G→A	100%	P205S (CCT→TCT)	arpA ←	ankyrin repeat protein
RA	4,213,578	C→A	24.8%	intergenic (‑22/‑178)	iclR ← / → metH	transcriptional repressor/homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent
RA	4,214,563	A→T	100%	T270S (ACC→TCC)	metH →	homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent
RA	4,214,809	G→T	100%	E352* (GAA→TAA)	metH →	homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent
RA	4,219,790	A→T	69.9%	L94Q (CTG→CAG)	pepE ←	(alpha)‑aspartyl dipeptidase
RA	4,219,858	G→T	61.3%	V71V (GTC→GTA)	pepE ←	(alpha)‑aspartyl dipeptidase
RA	4,221,214	C→A	70.2%	intergenic (+60/+73)	rluF → / ← yjbD	23S rRNA pseudouridine(2604) synthase/DUF3811 family protein
RA	4,223,670	C→A	9.7%	intergenic (‑509/‑16)	lysC ← / → pgi	lysine‑sensitive aspartokinase 3/glucosephosphate isomerase
RA	4,224,391	G→T	68.5%	V236F (GTT→TTT)	pgi →	glucosephosphate isomerase
RA	4,224,685	G→T	27.8%	A334S (GCG→TCG)	pgi →	glucosephosphate isomerase
RA	4,225,741	G→T	100%	intergenic (+406/‑93)	pgi → / → yjbE	glucosephosphate isomerase/extracellular polysaccharide production threonine‑rich protein
RA	4,225,841	A→C	100%	K3T (AAA→ACA)	yjbE →	extracellular polysaccharide production threonine‑rich protein
RA	4,230,049	G→T	28.1%	intergenic (‑66/‑204)	yjbT ← / → psiE	putative periplasmic protein/phosphate starvation inducible protein
RA	4,230,913	A→T	100%	W424R (TGG→AGG)	xylE ←	D‑xylose transporter
RA	4,235,869	G→T	100%	A160E (GCG→GAG)	malE ←	maltose transporter subunit
RA	4,235,916	G→T	100%	N144K (AAC→AAA)	malE ←	maltose transporter subunit
RA	4,236,666	C→A	100%	intergenic (‑319/‑46)	malE ← / → malK	maltose transporter subunit/fused maltose transport subunit, ATP‑binding component of ABC superfamily/regulatory protein
RA	4,241,153	G→T	8.9%	pseudogene (265/1323 nt)	yjbI →	pseudogene, SopA‑related, pentapeptide repeats‑containing
RA	4,242,509	C→T	100%	L26F (CTC→TTC)	ubiC →	chorismate‑‑pyruvate lyase
RA	4,244,663	G→T	56.5%	H578N (CAC→AAC)	plsB ←	glycerol‑3‑phosphate O‑acyltransferase
RA	4,245,537	G→T	100%	N286K (AAC→AAA)	plsB ←	glycerol‑3‑phosphate O‑acyltransferase
RA	4,247,370	G→T	13.8%	D110Y (GAT→TAT)	lexA →	transcriptional repressor of SOS regulon
RA	4,249,117	G→T	100%	intergenic (+68/‑48)	dinF → / → yjbJ	oxidative stress resistance protein; putative MATE family efflux pump; UV and mitomycin C inducible protein/stress‑induced protein, UPF0337 family
RA	4,251,044	T→G	5.8%	L173R (CTG→CGG)	yjbM →	uncharacterized protein
RA	4,252,556	A→T	5.3%	L320F (TTA→TTT)	dusA →	tRNA‑dihydrouridine synthase A
RA	4,255,009	A→T	100%	V256V (GTA→GTT)	dnaB →	replicative DNA helicase
RA	4,258,754	T→A	12.9%	T63S (ACG→TCG)	yjbS ←	uncharacterized protein
RA	4,265,064	C→A	100%	intergenic (‑95/‑335)	yjcB ← / → yjcC	putative inner membrane protein/putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA	4,265,089	T→A	100%	intergenic (‑120/‑310)	yjcB ← / → yjcC	putative inner membrane protein/putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA	4,266,208	T→A	31.5%	S270S (TCT→TCA)	yjcC →	putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA	4,266,318	G→T	100%	R307L (CGT→CTT)	yjcC →	putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA	4,269,251	A→T	9.2%	Q282L (CAG→CTG)	yjcD →	inner membrane putative guanine permease
RA	4,269,869	C→A	28.4%	intergenic (+113/‑39)	yjcD → / → yjcE	inner membrane putative guanine permease/putative cation/proton antiporter
RA	4,272,352	T→C	68.3%	T218A (ACT→GCT)	yjcF ←	pentapeptide repeats protein
RA	4,274,337	T→A	6.8%	Q165L (CAG→CTG)	actP ←	acetate transporter
RA	4,274,641	A→C	9.8%	Y64D (TAC→GAC)	actP ←	acetate transporter
RA	4,274,926	A→C	100%	I72M (ATT→ATG)	yjcH ←	DUF485 family inner membrane protein
RA	4,275,142	C→A	100%	intergenic (‑1/+199)	yjcH ← / ← acs	DUF485 family inner membrane protein/acetyl‑CoA synthetase
RA	4,275,862	C→A	100%	D480Y (GAT→TAT)	acs ←	acetyl‑CoA synthetase
RA	4,279,816	G→T	72.8%	A27A (GCG→GCT)	nrfC →	formate‑dependent nitrite reductase, 4Fe4S subunit
RA	4,285,970	C→T	5.1%	intergenic (+248/+283)	gltP → / ← yjcO	glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein
RA	4,288,086	G→T	100%	F366L (TTC→TTA)	fdhF ←	formate dehydrogenase‑H, selenopolypeptide subunit
RA	4,289,247	G→A	57.5%	intergenic (‑64/+134)	fdhF ← / ← mdtP	formate dehydrogenase‑H, selenopolypeptide subunit/outer membrane factor of efflux pump
RA	4,290,080	G→T	100%	I256I (ATC→ATA)	mdtP ←	outer membrane factor of efflux pump
RA	4,297,485	G→C	100%	G44G (GGC→GGG)	alsK ←	D‑allose kinase
RA	4,297,846	C→A	100%	M150I (ATG→ATT)	alsE ←	allulose‑6‑phosphate 3‑epimerase
RA	4,303,614	T→A	100%	*150R (TGA→AGA)	rpiB →	ribose 5‑phosphate isomerase B/allose 6‑phosphate isomerase
RA	4,309,746	G→T	9.0%	V245V (GTC→GTA)	phnI ←	ribophosphonate triphosphate synthase complex putative catalytic subunit
RA	4,315,765	A→G	5.4%	intergenic (‑207/+451)	yjdN ← / ← yjdM	metalloprotein superfamily protein/zinc‑ribbon family protein
RA	4,318,517	A→T	100%	T522T (ACA→ACT)	crfC →	clamp‑binding sister replication fork colocalization protein, dynamin‑related
RA	4,321,863	A→T	28.5%	intergenic (+42/‑70)	proP → / → pmrR	proline/glycine betaine transporter/putative membrane‑bound BasS regulator
RA	4,329,774	C→A	100%	D189Y (GAC→TAC)	adiA ←	arginine decarboxylase
RA	4,330,426	Δ1 bp	100%	intergenic (‑88/+111)	adiA ← / ← melR	arginine decarboxylase/melibiose operon transcriptional regulator; autoregulator
RA	4,337,551	C→A	29.3%	V337V (GTG→GTT)	dcuB ←	C4‑dicarboxylate transporter, anaerobic; DcuS co‑sensor
RA	4,337,927	A→T	53.4%	V212E (GTA→GAA)	dcuB ←	C4‑dicarboxylate transporter, anaerobic; DcuS co‑sensor
RA	4,341,023	A→T	100%	Y153N (TAC→AAC)	dcuS ←	sensory histidine kinase in two‑component regulatory system with DcuR, regulator of anaerobic fumarate respiration
RA	4,347,596	A→T	11.2%	F280Y (TTC→TAC)	cadA ←	lysine decarboxylase, acid‑inducible
RA	4,350,223	G→A	100%	A510V (GCT→GTT)	cadC ←	cadBA operon transcriptional activator
RA	4,352,529	C→A	12.3%	intergenic (‑86/+21)	pheU ← / ← yjdC	tRNA‑Phe/putative transcriptional regulator
RA	4,356,198	A→T	10.1%	S131S (TCT→TCA)	dcuA ←	C4‑dicarboxylate antiporter
RA	4,358,390	A→C	100%	intergenic (‑246/‑91)	aspA ← / → fxsA	aspartate ammonia‑lyase/suppressor of F exclusion of phage T7
RA	4,358,920	G→T	100%	R147L (CGC→CTC)	fxsA →	suppressor of F exclusion of phage T7
RA	4,359,686	C→A	30.2%	E182* (GAA→TAA)	yjeH ←	putative transporter
RA	4,366,322	A→C	100%	intergenic (+63/‑48)	ecnA → / → ecnB	entericidin A membrane lipoprotein, antidote entericidin B/entericidin B membrane lipoprotein
RA	4,376,178	C→A	100%	E1004* (GAA→TAA)	mscM ←	mechanosensitive channel protein, miniconductance
RA	4,378,778	G→T	100%	S137* (TCG→TAG)	mscM ←	mechanosensitive channel protein, miniconductance
RA	4,380,610	G→T	12.2%	I239I (ATC→ATA)	rsgA ←	ribosome small subunit‑dependent GTPase A
RA	4,381,504	T→A	100%	I28I (ATT→ATA)	orn →	oligoribonuclease
RA	4,382,218	C→A	100%	noncoding (42/76 nt)	glyV →	tRNA‑Gly
RA	4,384,268	C→A	13.2%	S129* (TCG→TAG)	nnr →	bifunctional NAD(P)H‑hydrate repair enzyme; C‑terminal domain ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase and N‑terminal domain NAD(P)H‑hydrate epimerase
RA	4,388,439	T→A	70.0%	V404E (GTG→GAG)	mutL →	methyl‑directed mismatch repair protein
RA	4,388,902	G→T	100%	A558A (GCG→GCT)	mutL →	methyl‑directed mismatch repair protein
RA	4,394,875	G→T	100%	A124A (GCG→GCT)	purA →	adenylosuccinate synthetase
RA	4,396,598	A→T	100%	E43V (GAA→GTA)	rnr →	exoribonuclease R, RNase R
RA	4,400,699	G→T	7.8%	V110V (GTG→GTT)	yjfJ →	PspA/IM30 family protein
RA	4,402,850	G→T	100%	L2L (CTG→CTT)	yjfC →	ATP‑Grasp family ATPase
RA	4,404,169	G→T	100%	A26A (GCG→GCT)	aidB →	DNA alkylation damage repair protein; flavin‑containing DNA binding protein, weak isovaleryl CoA dehydrogenase
RA	4,405,730	G→T	100%	intergenic (+13/+104)	aidB → / ← yjfN	DNA alkylation damage repair protein; flavin‑containing DNA binding protein, weak isovaleryl CoA dehydrogenase/DUF1471 family periplasmic protein
RA	4,406,553	C→A	100%	R12L (CGG→CTG)	bsmA ←	bioflm peroxide resistance protein
RA	4,409,651	C→T	5.2%	intergenic (‑209/‑146)	ulaG ← / → ulaA	L‑ascorbate 6‑phosphate lactonase/L‑ascorbate‑specific enzyme IIC permease component of PTS
RA	4,410,964	A→C	100%	I390L (ATC→CTC)	ulaA →	L‑ascorbate‑specific enzyme IIC permease component of PTS
RA	4,412,786	G→T	100%	E42* (GAA→TAA)	ulaE →	L‑xylulose 5‑phosphate 3‑epimerase
RA	4,417,122	G→T	100%	R40S (CGT→AGT)	yjfZ ←	uncharacterized protein
RA	4,417,551	A→C	100%	pseudogene (41/402 nt)	ytfA →	pseudogene, related to transcriptional regulators
RA	4,427,647	G→A	100%	D42N (GAT→AAT)	ytfI →	uncharacterized protein
RA	4,428,092	G→T	100%	G190V (GGA→GTA)	ytfI →	uncharacterized protein
RA	4,432,031	G→A	100%	intergenic (‑38/‑168)	msrA ← / → tamA	methionine sulfoxide reductase A/translocation and assembly module for autotransporter export, outer membrane subunit
RA	4,434,260	C→A	100%	P111H (CCT→CAT)	tamB →	translocation and assembly module for autotransporter export, inner membrane subunit
RA	4,436,662	G→T	28.6%	G912C (GGT→TGT)	tamB →	translocation and assembly module for autotransporter export, inner membrane subunit
RA	4,445,338	T→G	8.0%	K30T (AAA→ACA)	fbp ←	fructose‑1,6‑bisphosphatase I
RA	4,445,440	C→A	11.2%	intergenic (‑14/‑162)	fbp ← / → mpl	fructose‑1,6‑bisphosphatase I/UDP‑N‑acetylmuramate:L‑alanyl‑gamma‑D‑glutamyl‑ meso‑diaminopimelate ligase
RA	4,445,719	A→T	100%	T40S (ACC→TCC)	mpl →	UDP‑N‑acetylmuramate:L‑alanyl‑gamma‑D‑glutamyl‑ meso‑diaminopimelate ligase
RA	4,456,233	G→T	100%	I277I (ATC→ATA)	treR ←	trehalose 6‑phosphate‑inducible trehalose regulon transcriptional repressor
RA	4,457,282	G→T	19.7%	R12I (AGA→ATA)	mgtL →	regulatory leader peptide for mgtA
RA	4,457,499	C→A	100%	R20S (CGT→AGT)	mgtA →	magnesium transporter
RA	4,458,254	T→A	100%	V271V (GTT→GTA)	mgtA →	magnesium transporter
RA	4,458,609	G→T	100%	D390Y (GAT→TAT)	mgtA →	magnesium transporter
RA	4,458,948	G→T	100%	D503Y (GAT→TAT)	mgtA →	magnesium transporter
RA	4,465,936	T→A	100%	L228* (TTA→TAA)	yjgL →	uncharacterized protein
RA	4,468,165	A→G	100%	intergenic (‑37/‑125)	argI ← / → rraB	ornithine carbamoyltransferase 1/protein inhibitor of RNase E
RA	4,469,550	G→A	100%	A2T (GCT→ACT)	yjgN →	DUF898 family inner membrane protein
RA	4,470,017	G→A	100%	M157I (ATG→ATA)	yjgN →	DUF898 family inner membrane protein
RA	4,470,873	G→T	100%	R928S (CGT→AGT)	valS ←	valyl‑tRNA synthetase
RA	4,471,930	T→A	100%	P575P (CCA→CCT)	valS ←	valyl‑tRNA synthetase
RA	4,480,139	G→T	100%	A273E (GCG→GAG)	idnR ←	transcriptional repressor, 5‑gluconate‑binding
RA	4,493,435	T→C	100%	intergenic (‑187/‑440)	insG ← / → yjhB	IS4 transposase/putative transporter
RA	4,494,721	G→A	100%	A283T (GCC→ACC)	yjhB →	putative transporter
RA	4,495,463	G→T	6.8%	M120I (ATG→ATT)	yjhC →	putative oxidoreductase
RA	4,495,859	T→G	100%	D252E (GAT→GAG)	yjhC →	putative oxidoreductase
RA	4,499,530	G→T	28.5%	pseudogene (705/785 nt)	insO →	pseudogene, IS911 transposase B;IS, phage, Tn; Transposon‑related functions; extrachromosomal; transposon related
RA	4,505,141	G→T	100%	R452S (CGT→AGT)	fecA ←	ferric citrate outer membrane transporter
RA	4,512,693	T→A	100%	K407* (AAG→TAG)	yjhG ←	putative dehydratase
RA	4,513,759	T→A	6.0%	G51G (GGA→GGT)	yjhG ←	putative dehydratase
RA	4,520,701	G→T	100%	G256G (GGC→GGA)	sgcX ←	putative endoglucanase with Zn‑dependent exopeptidase domain
RA	4,523,001	T→A	100%	intergenic (‑1/+55)	yjhP ← / ← yjhQ	putative methyltransferase/putative acetyltransferase
RA	4,525,234	G→A	100%	pseudogene (415/1029 nt)	yjhR →	pseudogene, helicase family; putative frameshift suppressor
RA	4,531,143	A→T	100%	I124F (ATT→TTT)	fimB →	tyrosine recombinase/inversion of on/off regulator of fimA
RA	4,531,562	C→T	6.9%	intergenic (+186/‑292)	fimB → / → fimE	tyrosine recombinase/inversion of on/off regulator of fimA/tyrosine recombinase/inversion of on/off regulator of fimA
RA	4,533,538	A→T	23.5%	intergenic (+58/‑7)	fimA → / → fimI	major type 1 subunit fimbrin (pilin)/fimbrial protein involved in type 1 pilus biosynthesis
RA	4,536,446	A→T	29.8%	K512* (AAG→TAG)	fimD →	fimbrial usher outer membrane porin protein; FimCD chaperone‑usher
RA	4,541,306	C→T	24.1%	intergenic (‑193/‑147)	gntP ← / → uxuA	fructuronate transporter/mannonate hydrolase
RA	4,541,449	A→T	100%	intergenic (‑336/‑4)	gntP ← / → uxuA	fructuronate transporter/mannonate hydrolase
RA	4,543,413	G→T	5.3%	A232A (GCG→GCT)	uxuB →	D‑mannonate oxidoreductase, NAD‑dependent
RA	4,545,107	G→T	28.8%	D239Y (GAT→TAT)	uxuR →	fructuronate‑inducible hexuronate regulon transcriptional repressor; autorepressor
RA	4,545,608	C→A	100%	R177I (AGA→ATA)	yjiC ←	uncharacterized protein
RA	4,546,672	G→T	26.0%	intergenic (‑535/‑138)	yjiC ← / → iraD	uncharacterized protein/RpoS stabilzer after DNA damage, anti‑RssB factor
RA	4,547,818	C→A	100%	D97Y (GAT→TAT)	hypT ←	hypochlorite‑responsive transcription factor
RA	4,548,084	A→T	76.7%	L8* (TTG→TAG)	hypT ←	hypochlorite‑responsive transcription factor
RA	4,555,156	G→T	100%	A171E (GCG→GAG)	yjiM ←	putative 2‑hydroxyglutaryl‑CoA dehydratase
RA	4,562,043	C→A	100%	intergenic (+311/‑188)	yjiS → / → yjiT	DUF1127 family protein/pseudogene
RA	4,562,736	A→C	7.7%	pseudogene (506/1503 nt)	yjiT →	pseudogene
RA	4,564,597	A→C	8.2%	pseudogene (862/2937 nt)	yjiV →	pseudogene; conserved hypothetical protein
RA	4,567,278	G→T	100%	I166I (ATC→ATA)	mcrC ←	5‑methylcytosine‑specific restriction enzyme McrBC, subunit McrC
RA	4,571,233	G→A	100%	S16F (TCT→TTT)	hsdS ←	specificity determinant for hsdM and hsdR
RA	4,572,520	A→T	100%	Y116N (TAC→AAC)	hsdM ←	DNA methyltransferase M
RA	4,575,840	A→C	8.4%	pseudogene (793/3567 nt)	hsdR ←	pseudogene, premature stop codon, host restriction; endonuclease R
RA	4,584,255	A→C	100%	L95L (CTT→CTG)	yjjL ←	L‑galactonate transporter
RA	4,584,381	G→T	100%	I53I (ATC→ATA)	yjjL ←	L‑galactonate transporter
RA	4,584,756	A→T	100%	*305K (TAA→AAA)	yjjM ←	yjjMN operon transcriptional activator
RA	4,584,775	C→A	100%	E298D (GAG→GAT)	yjjM ←	yjjMN operon transcriptional activator
RA	4,585,213	G→T	7.5%	F152L (TTC→TTA)	yjjM ←	yjjMN operon transcriptional activator
RA	4,585,338	A→T	100%	S111T (TCT→ACT)	yjjM ←	yjjMN operon transcriptional activator
RA	4,588,180	G→T	100%	S360* (TCA→TAA)	opgB ←	phosphoglycerol transferases I and II
RA	4,589,130	G→T	100%	I43I (ATC→ATA)	opgB ←	phosphoglycerol transferases I and II
RA	4,591,139	C→A	100%	D66Y (GAT→TAT)	dnaT ←	DNA biosynthesis protein (primosomal protein I)
RA	4,596,243	T→A	100%	intergenic (‑25/+243)	leuQ ← / ← rsmC	tRNA‑Leu/16S rRNA m(2)G1207 methyltransferase, SAM‑dependent
RA	4,596,487	T→A	37.6%	*344L (TAA→TTA)	rsmC ←	16S rRNA m(2)G1207 methyltransferase, SAM‑dependent
RA	4,600,972	G→T	100%	intergenic (+152/‑241)	prfC → / → osmY	peptide chain release factor RF‑3/periplasmic protein
RA	4,604,195	A→G	5.0%	intergenic (+118/+302)	yjjV → / ← yjjW	putative DNase/putative pyruvate formate lyase activating enzyme
RA	4,604,320	T→C	5.2%	intergenic (+243/+177)	yjjV → / ← yjjW	putative DNase/putative pyruvate formate lyase activating enzyme
RA	4,606,167	G→T	7.3%	S239* (TCA→TAA)	yjjI ←	DUF3029 family protein, putative glycine radical enzyme
RA	4,609,543	G→T	30.8%	E42* (GAA→TAA)	deoB →	phosphopentomutase
RA	4,615,947	G→T	100%	E73D (GAG→GAT)	radA →	DNA repair protein
RA	4,617,341	C→A	100%	F70L (TTC→TTA)	nadR →	trifunctional protein: nicotinamide mononucleotide adenylyltransferase, ribosylnicotinamide kinase, transcriptional repressor
RA	4,617,970	A→C	12.6%	Q280P (CAG→CCG)	nadR →	trifunctional protein: nicotinamide mononucleotide adenylyltransferase, ribosylnicotinamide kinase, transcriptional repressor
RA	4,625,288	T→C	100%	intergenic (‑161/‑50)	rob ← / → creA	right oriC‑binding transcriptional activator, AraC family/putative periplasmic protein
RA	4,630,770	G→T	100%	T4T (ACG→ACT)	yjtD →	putative methyltransferase

Unassigned missing coverage evidence
			seq id	start	end	size	←reads	reads→	gene	description
*	*	÷	CP009273	373832	375099	1268	200 [197]	[196] 199	frmA–[frmR]	frmA,[frmR]
*	*	÷	CP009273	1191688	1206939	15252	199 [195]	[198] 200	[icd]–[icdC]	[icd],ymfD,ymfE,lit,intE,xisE,ymfI,ymfJ,cohE,croE,ymfL,ymfM,oweE,aaaE,ymfR,beeE,jayE,ymfQ,stfP,tfaP,tfaE,stfE,pinE,mcrA,[icdC]
*	*	÷	CP009273	4100598	4101520	923	200 [193]	[196] 199	[cdh]–tpiA	[cdh],tpiA

Unassigned new junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	CP009273	360104 =	215 (0.710)	157 (0.520)	88/278	NT	42.2%	intergenic (‑38/+557)	lacZ/lacI	pseudogene, truncated/DNA‑binding transcriptional repressor
	?	CP009273	= 360286	NA (NA)					intergenic (‑220/+375)	lacZ/lacI	pseudogene, truncated/DNA‑binding transcriptional repressor
*	?	CP009273	= 360278	NA (NA)	8089 (28.220) +TTAATTAA	195/262	NT	96.9%	intergenic (‑212/+383)	lacZ/lacI	pseudogene, truncated/DNA‑binding transcriptional repressor
	?	CP009273	= 361823	272 (0.890)					coding (831/834 nt)	mhpR	mhp operon transcriptional activator
*	?	CP009273	360652 =	317 (1.040)	5916 (29.160) +46 bp	186/186	NT	97.0%	intergenic (‑586/+9)	lacZ/lacI	pseudogene, truncated/DNA‑binding transcriptional repressor
	?	CP009273	= 1317577	234 (0.770)					coding (101/882 nt)	yciV	PHP domain protein
*	?	CP009273	360652 =	317 (1.040)	1996 (9.840) +46 bp	186/186	NT	91.6%	intergenic (‑586/+9)	lacZ/lacI	pseudogene, truncated/DNA‑binding transcriptional repressor
	?	CP009273	= 1317577	234 (0.770)					coding (101/882 nt)	yciV	PHP domain protein
*	?	CP009273	= 361823	272 (0.890)	47 (0.160) +TTAATTAA	7/262	NT	16.0%	coding (831/834 nt)	mhpR	mhp operon transcriptional activator
	?	CP009273	4033991 =	251 (0.820)					noncoding (115/120 nt)	rrfA	5S ribosomal RNA of rrnA operon
*	?	CP009273	376716 =	NA (NA)	293 (0.960)	158/278	NT	99.7%	intergenic (‑1/‑91)	yaiX/insC1	pseudogene, interrupted by IS2A, acetyltransferase homolog; nonfunctional; interruped by IS2; putative transferase/IS2 repressor TnpA
	?	CP009273	566411 =	1 (0.000)					coding (63/552 nt)	ybcL	inactive polymorphonuclear leukocyte migration suppressor; DLP12 prophage; secreted protein, UPF0098 family
*	?	CP009273	= 378046	NA (NA)	351 (1.150)	173/278	NT	99.7%	intergenic (+11/+1)	insD1/yaiX	IS2 transposase TnpB/pseudogene, interrupted by IS2A, acetyltransferase homolog; nonfunctional; interruped by IS2; putative transferase
	?	CP009273	= 566415	1 (0.000)					coding (67/552 nt)	ybcL	inactive polymorphonuclear leukocyte migration suppressor; DLP12 prophage; secreted protein, UPF0098 family
*	?	CP009273	776825 =	165 (0.540)	27 (0.090) +G	14/276	NT	12.7%	noncoding (1/76 nt)	lysZ	tRNA‑Lys
	?	CP009273	= 2514488	208 (0.680)					noncoding (216/1345 nt)	IS186	repeat region
*	?	CP009273	= 776902	193 (0.630)	10 (0.040)	4/238	NT	5.1%	intergenic (+2/‑131)	lysZ/lysQ	tRNA‑Lys/tRNA‑Lys
	?	CP009273	777267 =	205 (0.790)					intergenic (+159/‑274)	lysQ/nadA	tRNA‑Lys/quinolinate synthase, subunit A
*	?	CP009273	777033 =	199 (0.650)	53 (0.180) +G	3/276	NT	20.8%	noncoding (1/76 nt)	lysQ	tRNA‑Lys
	?	CP009273	= 2514488	208 (0.680)					noncoding (216/1345 nt)	IS186	repeat region
*	?	CP009273	1635219 =	0 (0.000)	374 (1.250)	164/274	NT	100%	intergenic (‑377/+377)	essQ/cspB	Qin prophage; putative S lysis protein/Qin prophage; cold shock protein
	?	CP009273	= 2063752	NA (NA)					noncoding (1/1331 nt)	IS2	repeat region
*	?	CP009273	= 1635223	0 (0.000)	299 (0.980)	157/278	NT	100%	intergenic (‑381/+373)	essQ/cspB	Qin prophage; putative S lysis protein/Qin prophage; cold shock protein
	?	CP009273	= 1645805	NA (NA)					intergenic (+11/‑3)	insD1/intQ	IS2 transposase TnpB;IS, phage, Tn; Transposon‑related functions; extrachromosomal; transposon related/pseudogene, Qin prophage; phage integrase family;Phage or Prophage Related
*	?	CP009273	= 2509092	NA (NA)	15 (0.050)	14/272	NT	5.0%	intergenic (+170/+30)	insL1/yfeA	IS186 transposase/putative diguanylate cyclase
	?	CP009273	= 4533433	290 (0.950)					coding (502/549 nt)	fimA	major type 1 subunit fimbrin (pilin)
*	?	CP009273	3179455 =	NA (NA)	27 (0.090)	21/278	NT	9.3%	intergenic (+7/‑91)	yqiG/insC1	pseudogene; fimbrial export usher family;putative membrane; Not classified; putative membrane protein/IS2 repressor TnpA
	?	CP009273	= 4346539	263 (0.860)					coding (1896/2148 nt)	cadA	lysine decarboxylase, acid‑inducible
*	?	CP009273	= 3180783	NA (NA)	329 (1.100)	172/274	NT	97.7%	pseudogene (4/2445 nt)	yqiG	pseudogene; fimbrial export usher family;putative membrane; Not classified; putative membrane protein
	?	CP009273	= 3833569	8 (0.030)					intergenic (‑216/‑6)	nlpA/yicS	cytoplasmic membrane lipoprotein‑28/putative periplasmic protein
*	?	CP009273	= 3180785	NA (NA)	25 (0.080)	18/278	NT	8.8%	pseudogene (6/2445 nt)	yqiG	pseudogene; fimbrial export usher family;putative membrane; Not classified; putative membrane protein
	?	CP009273	4346535 =	258 (0.850)					coding (1900/2148 nt)	cadA	lysine decarboxylase, acid‑inducible
*	?	CP009273	3744959 =	297 (0.980)	158 (0.520)	99/278	NT	35.5%	coding (270/741 nt)	yiaT	putative outer membrane protein
	?	CP009273	= 3752673	277 (0.910)					coding (549/1845 nt)	selB	selenocysteinyl‑tRNA‑specific translation factor
*	?	CP009273	3833562 =	8 (0.030)	316 (1.050)	163/276	NT	97.5%	intergenic (‑209/‑13)	nlpA/yicS	cytoplasmic membrane lipoprotein‑28/putative periplasmic protein
	?	CP009273	4487999 =	NA (NA)					intergenic (+242/‑90)	intB/insC1	pseudogene, integrase homology;IS, phage, Tn; Phage‑related functions and prophages; KpLE2 phage‑like element; P4‑like integrase/IS2 repressor TnpA