breseq  version 0.35.4  revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation freq annotation gene description
RA 4,701 T→A 15.0% L323Q (CTG→CAG)  thrC → L‑threonine synthase
RA 5,144 G→A 100% intergenic (+124/‑90) thrC → / → yaaX L‑threonine synthase/DUF2502 family putative periplasmic protein
RA 7,522 G→T 100% F146L (TTC→TTA yaaJ ← putative transporter
RA 10,444 G→T 100% F17L (TTC→TTA satP ← succinate‑acetate transporter
RA 12,901 G→A 100% D247N (GAT→AAT)  dnaK → chaperone Hsp70, with co‑chaperone DnaJ
RA 13,962 A→C 22.8% E600D (GAA→GAC dnaK → chaperone Hsp70, with co‑chaperone DnaJ
RA 23,320 T→A 58.8% F310L (TTT→TTA ileS → isoleucyl‑tRNA synthetase
RA 24,012 A→T 8.5% H541L (CAC→CTC)  ileS → isoleucyl‑tRNA synthetase
RA 24,783 T→A 25.5% L798Q (CTG→CAG)  ileS → isoleucyl‑tRNA synthetase
RA 25,546 G→T 100% D114Y (GAC→TAC)  lspA → prolipoprotein signal peptidase (signal peptidase II)
RA 27,307 C→T 100% I5I (ATC→ATT rihC → ribonucleoside hydrolase 3
RA 29,139 G→T 100% G256C (GGT→TGT)  dapB → dihydrodipicolinate reductase
RA 31,710 C→A 100% I298I (ATC→ATA carB → carbamoyl‑phosphate synthase large subunit
RA 31,718 A→C 8.4% N301T (AAC→ACC)  carB → carbamoyl‑phosphate synthase large subunit
RA 32,659 C→A 100% R615S (CGC→AGC)  carB → carbamoyl‑phosphate synthase large subunit
RA 32,802 C→A 100% I662I (ATC→ATA carB → carbamoyl‑phosphate synthase large subunit
RA 40,957 C→A 100% V325V (GTG→GTT caiT ← putative transporter
RA 42,150 G→A 100% intergenic (‑219/‑253) caiT ← / → fixA putative transporter/anaerobic carnitine reduction putative electron transfer flavoprotein subunit
RA 42,342 G→T 12.8% intergenic (‑411/‑61) caiT ← / → fixA putative transporter/anaerobic carnitine reduction putative electron transfer flavoprotein subunit
RA 49,840 G→T 100% A6A (GCG→GCT folA → dihydrofolate reductase
RA 54,392 G→T 100% A104E (GCG→GAG)  surA ← peptidyl‑prolyl cis‑trans isomerase (PPIase)
RA 55,590 G→T 100% T507K (ACG→AAG)  lptD ← LPS assembly OM complex LptDE, beta‑barrel component
RA 56,677 G→T 100% R145S (CGC→AGC)  lptD ← LPS assembly OM complex LptDE, beta‑barrel component
RA 58,723 G→T 71.3% pseudogene (250/579 nt) yabP → pseudogene, pentapeptide repeats‑containing
RA 59,320 A→T 57.7% intergenic (+41/+367) yabP → / ← rluA pseudogene, pentapeptide repeats‑containing/dual specificity 23S rRNA pseudouridine(746), tRNA pseudouridine(32) synthase, SAM‑dependent
RA 61,967 A→C 27.0% L433R (CTG→CGG)  rapA ← RNA polymerase remodeling/recycling factor ATPase; RNA polymerase‑associated, ATP‑dependent RNA translocase
RA 68,546 C→A 22.2% R237S (CGC→AGC)  yabI → DedA family inner membrane protein
RA 76,821 G→T 100% G177G (GGC→GGA leuC ← 3‑isopropylmalate dehydratase large subunit
RA 78,007 C→A 27.2% G147C (GGT→TGT)  leuB ← 3‑isopropylmalate dehydrogenase, NAD(+)‑dependent
RA 80,123 C→T 100% G25S (GGC→AGC)  leuL ← leu operon leader peptide
RA 81,562 C→A 100% I236I (ATC→ATA leuO → global transcription factor
RA 82,037 C→T 100% intergenic (+238/‑80) leuO → / → ilvI global transcription factor/acetolactate synthase 3 large subunit
RA 88,635 C→A 14.0% R246S (CGC→AGC)  ftsI → transpeptidase involved in septal peptidoglycan synthesis (penicillin‑binding protein 3)
RA 93,391 G→T 100% T301T (ACG→ACT mraY → phospho‑N‑acetylmuramoyl‑pentapeptide transferase
RA 94,963 C→A 24.7% A25E (GCG→GAG)  ftsW → lipid II flippase; integral membrane protein involved in stabilizing FstZ ring during cell division
RA 97,521 C→A 100% A90A (GCC→GCA murC → UDP‑N‑acetylmuramate:L‑alanine ligase
RA 102,736 C→A 100% I315I (ATC→ATA ftsZ → GTP‑binding tubulin‑like cell division protein
RA 102,769 G→T 100% V326V (GTG→GTT ftsZ → GTP‑binding tubulin‑like cell division protein
RA 103,352 C→A 60.0% I103I (ATC→ATA lpxC → UDP‑3‑O‑acyl N‑acetylglucosamine deacetylase
RA 103,467 G→T 100% D142Y (GAT→TAT)  lpxC → UDP‑3‑O‑acyl N‑acetylglucosamine deacetylase
RA 104,561 G→T 100% A124S (GCG→TCG)  secM → regulator of secA translation
RA 108,039 C→A 100% intergenic (+119/+97) mutT → / ← yacG nucleoside triphosphate pyrophosphohydrolase, marked preference for dGTP/DNA gyrase inhibitor
RA 108,648 Δ1 bp 100% coding (439/744 nt) zapD ← FtsZ stabilizer
RA 118,548 G→A 22.5% intergenic (‑510/‑31) aroP ← / → pdhR aromatic amino acid transporter/pyruvate dehydrogenase complex repressor; autorepressor
RA 118,873 G→T 100% D99Y (GAC→TAC)  pdhR → pyruvate dehydrogenase complex repressor; autorepressor
RA 119,536 G→T 100% P11P (CCG→CCT aceE → pyruvate dehydrogenase, decarboxylase component E1, thiamine triphosphate‑binding
JC 123,063 (GCAGCGCCTGCGGCAGCTCCTGCGAAACAGGAAGCG)1→2 5.6% coding (882/1893 nt) aceF → pyruvate dehydrogenase, dihydrolipoyltransacetylase component E2
RA 134,028 G→T 100% A153A (GCG→GCT cueO → multicopper oxidase (laccase)
RA 134,297 C→A 25.6% S243* (TCG→TAG)  cueO → multicopper oxidase (laccase)
RA 135,689 A→T 69.1% L675Q (CTG→CAG)  gcd ← glucose dehydrogenase
RA 137,071 G→T 100% I214I (ATC→ATA gcd ← glucose dehydrogenase
RA 137,915 G→T 100% intergenic (‑203/‑3) gcd ← / → hpt glucose dehydrogenase/hypoxanthine phosphoribosyltransferase
RA 141,522 G→T 6.9% intergenic (+18/‑46) yadI → / → yadE putative PTS Enzyme IIA/putative polysaccharide deacetylase lipoprotein
RA 142,460 T→A 100% F298Y (TTC→TAC)  yadE → putative polysaccharide deacetylase lipoprotein
RA 145,641 A→T 7.0% Y150N (TAC→AAC)  panB ← 3‑methyl‑2‑oxobutanoate hydroxymethyltransferase
RA 145,894 G→T 12.2% I65I (ATC→ATA panB ← 3‑methyl‑2‑oxobutanoate hydroxymethyltransferase
RA 150,452 C→A 24.6% E488* (GAA→TAA)  htrE ← putative outer membrane usher protein
RA 153,472 G→T 100% intergenic (‑102/+268) yadN ← / ← folK putative fimbrial‑like adhesin protein/2‑amino‑4‑hydroxy‑6‑hydroxymethyldihyropteridine pyrophosphokinase
RA 158,287 C→A 100% D78Y (GAC→TAC)  ligT ← 2'‑5' RNA ligase
RA 159,666 G→T 100% G359C (GGT→TGT)  hrpB → putative ATP‑dependent helicase
RA 161,068 A→C 28.9% intergenic (+47/‑149) hrpB → / → mrcB putative ATP‑dependent helicase/fused glycosyl transferase and transpeptidase
RA 165,759 G→T 57.1% E597* (GAG→TAG)  fhuA → ferrichrome outer membrane transporter
RA 166,411 T→A 54.5% G49G (GGT→GGA fhuC → iron‑hydroxamate transporter subunit
RA 166,662 C→A 100% S133* (TCG→TAG)  fhuC → iron‑hydroxamate transporter subunit
RA 167,932 G→T 13.8% A291S (GCC→TCC)  fhuD → iron‑hydroxamate transporter subunit
RA 168,584 A→T 55.5% L212F (TTA→TTT fhuB → fused iron‑hydroxamate transporter subunits of ABC superfamily: membrane components
RA 173,725 G→T 100% G129G (GGC→GGA yadS ← UPF0126 family inner membrane protein
RA 176,783 G→T 100% D354Y (GAT→TAT)  dgt → deoxyguanosine triphosphate triphosphohydrolase
RA 185,393 A→T 100% F201I (TTC→ATC)  map ← methionine aminopeptidase
RA 186,159 A→G 100% intergenic (‑166/‑40) map ← / → tff methionine aminopeptidase/novel sRNA, function unknown
RA 190,772 G→T 7.2% V255V (GTG→GTT dxr → 1‑deoxy‑D‑xylulose 5‑phosphate reductoisomerase
RA 193,157 T→C 10.4% I42T (ATA→ACA)  rseP → inner membrane zinc RIP metalloprotease; RpoE activator, by degrading RseA; cleaved signal peptide endoprotease
RA 196,832 C→A 100% I806I (ATC→ATA bamA → BamABCDE complex OM biogenesis outer membrane pore‑forming assembly factor
RA 199,229 G→T 100% E61D (GAG→GAT lpxA → UDP‑N‑acetylglucosamine acetyltransferase
RA 201,962 A→T 100% D117V (GAT→GTT)  dnaE → DNA polymerase III alpha subunit
RA 208,013 G→T 100% M616I (ATG→ATT ldcC → lysine decarboxylase 2, constitutive
RA 212,137 G→T 18.3% E128* (GAA→TAA)  nlpE → lipoprotein involved with copper homeostasis and adhesion
RA 214,084 G→T 100% G393G (GGC→GGA proS ← prolyl‑tRNA synthetase
RA 216,136 G→T 25.8% P116Q (CCA→CAA)  rcsF ← putative outer membrane protein
RA 217,887 C→T 100% W74* (TGG→TGA metI ← DL‑methionine transporter subunit
RA 217,932 A→C 100% I59M (ATT→ATG metI ← DL‑methionine transporter subunit
RA 223,096 C→A 13.7% noncoding (851/2904 nt) rrlH → 23S ribosomal RNA of rrnH operon
RA 229,915 C→A 26.2% M176I (ATG→ATT mltD ← putative membrane‑bound lytic murein transglycosylase D
RA 230,579 C→T 100% E231K (GAA→AAA)  gloB ← hydroxyacylglutathione hydrolase
RA 231,378 C→A 100% R26S (CGC→AGC)  yafS → putative S‑adenosyl‑L‑methionine‑dependent methyltransferase
RA 232,860 G→T 100% D103Y (GAT→TAT)  dnaQ → DNA polymerase III epsilon subunit
RA 234,984 G→T 7.2% I80I (ATC→ATA) ‡ ykfM ← lethality reduction protein, putative inner membrane protein
RA 234,985 A→T 8.8% I80N (ATC→AAC) ‡ ykfM ← lethality reduction protein, putative inner membrane protein
RA 234,990 G→T 9.7% F78L (TTC→TTA ykfM ← lethality reduction protein, putative inner membrane protein
RA 234,994 G→T 13.9% S77* (TCA→TAA)  ykfM ← lethality reduction protein, putative inner membrane protein
RA 235,006 G→T 8.1% T73K (ACG→AAG)  ykfM ← lethality reduction protein, putative inner membrane protein
RA 235,010 G→T 12.6% L72I (CTT→ATT)  ykfM ← lethality reduction protein, putative inner membrane protein
RA 235,019 C→A 13.0% V69L (GTA→TTA)  ykfM ← lethality reduction protein, putative inner membrane protein
RA 235,022 G→T 7.9% H68N (CAT→AAT)  ykfM ← lethality reduction protein, putative inner membrane protein
RA 235,036 G→T 10.4% S63Y (TCC→TAC)  ykfM ← lethality reduction protein, putative inner membrane protein
RA 236,234 A→T 100% V148E (GTG→GAG)  yafV ← putative NAD(P)‑binding C‑N hydrolase family amidase
RA 237,417 A→C 68.1% F792V (TTT→GTT)  fadE ← acyl coenzyme A dehydrogenase
RA 238,195 G→T 100% V532V (GTC→GTA fadE ← acyl coenzyme A dehydrogenase
RA 238,303 A→T 26.7% V496V (GTT→GTA fadE ← acyl coenzyme A dehydrogenase
RA 239,583 C→A 29.1% A70S (GCG→TCG)  fadE ← acyl coenzyme A dehydrogenase
RA 245,020 G→T 13.4% pseudogene (1538/1713 nt) lfhA ← pseudogene, flagellar system protein, promoterless fragment; flagellar biosynthesis
RA 245,058 G→T 27.9% pseudogene (1500/1713 nt) lfhA ← pseudogene, flagellar system protein, promoterless fragment; flagellar biosynthesis
RA 245,306 C→A 70.7% pseudogene (1252/1713 nt) lfhA ← pseudogene, flagellar system protein, promoterless fragment; flagellar biosynthesis
RA 248,447 C→T 100% intergenic (+7/‑45) dinB → / → yafN DNA polymerase IV/antitoxin of the YafO‑YafN toxin‑antitoxin system
RA 248,486 C→A 100% intergenic (+46/‑6) dinB → / → yafN DNA polymerase IV/antitoxin of the YafO‑YafN toxin‑antitoxin system
RA 248,529 C→T 30.9% T13I (ACT→ATT)  yafN → antitoxin of the YafO‑YafN toxin‑antitoxin system
RA 249,008 T→A 7.0% L74* (TTG→TAG)  yafO → mRNA interferase toxin of the YafO‑YafN toxin‑antitoxin system
RA 250,909 A→T 100% L432Q (CTG→CAG)  pepD ← aminoacyl‑histidine dipeptidase (peptidase D)
RA 252,850 C→T 7.3% I129I (ATC→ATT gpt → xanthine phosphoribosyltransferase; xanthine‑guanine phosphoribosyltransferase
RA 253,855 G→T 100% R281L (CGT→CTT)  frsA → fermentation‑respiration switch protein; PTS Enzyme IIA(Glc)‑binding protein; pNP‑butyrate esterase activity
RA 255,301 G→T 7.4% Q171K (CAA→AAA)  phoE ← outer membrane phosphoporin protein E
RA 255,487 A→T 100% S109T (TCT→ACT)  phoE ← outer membrane phosphoporin protein E
RA 257,734 A→T 12.5% Q174L (CAG→CTG)  proA → gamma‑glutamylphosphate reductase
RA 259,494 G→T 100% C75* (TGC→TGA yafW ← CP4‑6 prophage; antitoxin of the YkfI‑YafW toxin‑antitoxin system
RA 262,114 C→A 100% D51Y (GAT→TAT)  yafY ← lipoprotein, inner membrane; overproduction stimulates degP expression; CP4‑6 prophage
RA 274,735 A→T 100% pseudogene (138/348 nt) afuB ← pseudogene, CP4‑6 prophage; ABC transporter permease family;Phage or Prophage Related
RA 277,970 G→A 6.4% intergenic (‑276/‑19) yagA ← / → yagE CP4‑6 prophage; putative DNA‑binding transcriptional regulator/2‑keto‑3‑deoxy gluconate (KDG) aldolase; CP4‑6 prophage
RA 279,098 G→T 23.7% E63* (GAG→TAG)  yagF → CP4‑6 prophage; dehydratase family protein
RA 279,334 C→A 100% I141I (ATC→ATA yagF → CP4‑6 prophage; dehydratase family protein
RA 279,800 G→T 100% E297* (GAA→TAA)  yagF → CP4‑6 prophage; dehydratase family protein
RA 280,968 G→T 60.6% intergenic (+89/‑138) yagF → / → yagG CP4‑6 prophage; dehydratase family protein/CP4‑6 prophage; putative sugar transporter
RA 282,700 G→T 6.9% P67P (CCG→CCT yagH → CP4‑6 prophage; putative xylosidase/arabinosidase
RA 285,966 A→T 12.7% P17P (CCT→CCA argF ← ornithine carbamoyltransferase 2, chain F; CP4‑6 prophage
RA 288,249 T→A 100% T137T (ACA→ACT yagK ← CP4‑6 prophage; conserved protein
RA 290,012 C→T 100% D167N (GAT→AAT)  yagM ← CP4‑6 prophage; uncharacterized protein
RA 291,348 G→A 100% intergenic (‑58/+59) yagN ← / ← intF CP4‑6 prophage; uncharacterized protein/CP4‑6 prophage; putative phage integrase
RA 294,795 C→A 25.2% L617L (CTG→CTT paoC ← PaoABC aldehyde oxidoreductase, Moco‑containing subunit
RA 294,929 C→A 100% E573* (GAA→TAA)  paoC ← PaoABC aldehyde oxidoreductase, Moco‑containing subunit
RA 299,522 G→T 7.9% intergenic (+206/+42) yagU → / ← ykgJ DUF1440 family inner membrane protein/UPF0153 cysteine cluster protein
RA 300,770 C→A 100% V49V (GTG→GTT ecpE ← ECP production pilus chaperone
RA 302,428 G→T 100% P34Q (CCG→CAG)  ecpD ← polymerized tip adhesin of ECP fibers
RA 307,479 G→A 100% intergenic (‑432/‑344) ecpR ← / → ykgL putative transcriptional regulator for the ecp operon/uncharacterized protein
RA 309,680 C→T 9.5% intergenic (‑164/‑388) ykgP ← / → eaeH pseudogene, oxidoreductase family/pseudogene, attaching and effacing protein homology;factor; Not classified
RA 312,532 G→A 100% pseudogene (349/684 nt) ykgA ← pseudogene, AraC family;putative regulator; Not classified; putative ARAC‑type regulatory protein
RA 314,566 C→A 100% D383Y (GAT→TAT)  rclA ← reactive chlorine stress species (RCS) resistance protein; pyridine nucleotide‑dependent disulfide oxidoreductase family
RA 317,105 T→A 60.3% intergenic (+313/‑214) rclR → / → ykgE reactive chlorine species (RCS)‑specific activator of the rcl genes/cysteine‑rich LutA family protein; putative electron transport chain YkgEFG component
RA 317,203 G→A 100% intergenic (+411/‑116) rclR → / → ykgE reactive chlorine species (RCS)‑specific activator of the rcl genes/cysteine‑rich LutA family protein; putative electron transport chain YkgEFG component
RA 317,205 G→A 100% intergenic (+413/‑114) rclR → / → ykgE reactive chlorine species (RCS)‑specific activator of the rcl genes/cysteine‑rich LutA family protein; putative electron transport chain YkgEFG component
RA 317,206 G→A 25.5% intergenic (+414/‑113) rclR → / → ykgE reactive chlorine species (RCS)‑specific activator of the rcl genes/cysteine‑rich LutA family protein; putative electron transport chain YkgEFG component
RA 319,024 C→A 100% R326S (CGC→AGC)  ykgF → ferridoxin‑like LutB family protein; putative electron transport chain YkgEFG component
RA 319,381 G→T 100% D445Y (GAC→TAC)  ykgF → ferridoxin‑like LutB family protein; putative electron transport chain YkgEFG component
RA 320,920 G→A 100% S52S (AGC→AGT ykgH ← putative inner membrane protein
RA 321,223 C→A 100% intergenic (‑148/+65) ykgH ← / ← betA putative inner membrane protein/choline dehydrogenase, a flavoprotein
RA 325,740 G→T 57.8% P189P (CCG→CCT betT → choline transporter of high affinity
RA 327,051 A→T 26.4% E626D (GAA→GAT betT → choline transporter of high affinity
RA 329,372 A→T 100% L258Q (CTG→CAG)  yahB ← putative DNA‑bindng transcriptional regulator
RA 332,599 G→T 100% A37A (GCG→GCT yahF → putative NAD(P)‑binding succinyl‑CoA synthase
RA 332,897 G→T 59.9% D137Y (GAT→TAT)  yahF → putative NAD(P)‑binding succinyl‑CoA synthase
RA 335,247 C→A 100% N404K (AAC→AAA yahG → DUF1116 family protein
RA 337,720 G→T 100% E295D (GAG→GAT yahJ → putative metallo‑dependent hydrolase domain deaminase
RA 339,348 G→T 24.5% D252Y (GAC→TAC)  yahK → aldehyde reductase, NADPH‑dependent, Zn‑containing, broad specificity
RA 344,800 G→T 100% E136D (GAG→GAT prpB → 2‑methylisocitrate lyase
RA 350,055 G→T 6.6% D547Y (GAC→TAC)  prpE → propionate‑‑CoA ligase
RA 350,559 G→T 29.0% intergenic (+256/‑74) prpE → / → codB propionate‑‑CoA ligase/cytosine transporter
RA 353,486 A→T 5.9% intergenic (+321/+16) codA → / ← cynR cytosine/isoguanine deaminase/transcriptional activator of cyn operon; autorepressor
RA 360,156 C→G 7.2% intergenic (‑90/+505) lacZ ← / ← lacI pseudogene, truncated/DNA‑binding transcriptional repressor
RA 360,173 C→A 6.4% intergenic (‑107/+488) lacZ ← / ← lacI pseudogene, truncated/DNA‑binding transcriptional repressor
RA 360,752 A→G 100% V331A (GTG→GCG)  lacI ← DNA‑binding transcriptional repressor
RA 360,969 C→A 15.5% E259* (GAG→TAG)  lacI ← DNA‑binding transcriptional repressor
RA 360,995 G→T 41.8% A250E (GCG→GAG)  lacI ← DNA‑binding transcriptional repressor
JC 361,139 +GCCA 12.0% coding (605/1083 nt) lacI ← DNA‑binding transcriptional repressor
RA 361,692 G→T 36.4% Q18K (CAG→AAG)  lacI ← DNA‑binding transcriptional repressor
RA 361,806 G→A 100% intergenic (‑63/+14) lacI ← / ← mhpR DNA‑binding transcriptional repressor/mhp operon transcriptional activator
RA 362,159 G→T 100% I165I (ATC→ATA mhpR ← mhp operon transcriptional activator
RA 362,629 A→T 100% Y9N (TAC→AAC)  mhpR ← mhp operon transcriptional activator
RA 364,561 G→T 100% D18Y (GAC→TAC)  mhpB → 2,3‑dihydroxyphenylpropionate 1,2‑dioxygenase
RA 372,091 C→A 100% R393R (CGG→AGG)  mhpT → 3‑hydroxyphenylpropionic transporter
RA 372,581 G→T 100% A118A (GCG→GCT yaiL → DUF2058 family protein
RA 378,179 A→T 100% pseudogene (150/282 nt) yaiX ← pseudogene, interrupted by IS2A, acetyltransferase homolog; nonfunctional; interruped by IS2; putative transferase
RA 385,815 G→T 100% pseudogene (109/1458 nt) yaiT → pseudogene, autotransporter family;putative structure; Not classified; interrupted by IS3; putative flagellin structural protein
RA 390,551 T→G 100% L197R (CTG→CGG)  yaiV → putative transcriptional regulator
RA 396,883 A→G 100% Q14Q (CAA→CAG iraP → anti‑RssB factor, RpoS stabilzer during Pi starvation; anti‑adapter protein
RA 397,959 G→A 100% A253T (GCG→ACG)  phoA → bacterial alkaline phosphatase
RA 400,594 G→T 100% V169V (GTC→GTA proC ← pyrroline‑5‑carboxylate reductase, NAD(P)‑binding
RA 402,340 G→T 100% V160V (GTG→GTT aroL → shikimate kinase II
RA 404,712 A→T 26.0% F255Y (TTC→TAC)  rdgC ← nucleoid‑associated ssDNA and dsDNA binding protein; competitive inhibitor of RecA function
RA 406,075 C→A 100% P159Q (CCG→CAG)  mak → manno(fructo)kinase
RA 407,711 G→T 12.2% A76E (GCG→GAG)  araJ ← arabinose‑inducible putative transporter, MFS family
RA 411,027 G→T 100% L61L (CTC→CTA sbcC ← exonuclease, dsDNA, ATP‑dependent
RA 411,556 C→A 24.6% D285Y (GAT→TAT)  sbcD ← exonuclease, dsDNA, ATP‑dependent
RA 412,004 A→T 5.5% R135R (CGT→CGA sbcD ← exonuclease, dsDNA, ATP‑dependent
RA 415,049 G→T 24.4% M1M (ATG→ATT) † brnQ → branched‑chain amino acid transport system 2 carrier protein; LIV‑II transport system for Ile, Leu, and Val
RA 421,799 C→A 100% I69I (ATC→ATA tgt → tRNA‑guanine transglycosylase
RA 424,393 G→T 5.7% A431S (GCG→TCG)  secD → SecYEG protein translocase auxillary subunit
RA 425,143 G→T 100% T61T (ACG→ACT secF → SecYEG protein translocase auxillary subunit
RA 426,157 G→T 100% E33* (GAG→TAG)  yajD → HNH nuclease family protein
RA 427,575 A→G 25.4% intergenic (‑106/+193) tsx ← / ← yajI nucleoside channel, receptor of phage T6 and colicin K/putative lipoprotein
RA 430,523 G→A 25.1% A141T (GCA→ACA)  ribE → riboflavin synthase beta chain
RA 432,762 G→T 100% P277Q (CCG→CAG)  yajO ← 2‑carboxybenzaldehyde reductase
RA 433,551 G→T 100% S14Y (TCC→TAC)  yajO ← 2‑carboxybenzaldehyde reductase
RA 434,663 A→C 100% I324S (ATC→AGC)  dxs ← 1‑deoxyxylulose‑5‑phosphate synthase, thiamine triphosphate‑binding, FAD‑requiring
RA 435,336 G→T 100% Q100K (CAG→AAG)  dxs ← 1‑deoxyxylulose‑5‑phosphate synthase, thiamine triphosphate‑binding, FAD‑requiring
RA 435,862 A→T 100% T232T (ACT→ACA ispA ← geranyltranstransferase
RA 437,672 T→A 100% V223E (GTG→GAG)  thiI → tRNA s(4)U8 sulfurtransferase
RA 444,489 G→A 100% R537C (CGT→TGT)  cyoB ← cytochrome o ubiquinol oxidase subunit I
RA 446,369 T→G 100% Q233P (CAG→CCG)  cyoA ← cytochrome o ubiquinol oxidase subunit II
RA 449,423 G→T 10.2% I67I (ATC→ATA yajG ← putative lipoprotein
RA 450,290 G→A 100% intergenic (+45/‑299) bolA → / → tig stationary‑phase morphogene, transcriptional repressor for mreB; also regulator for dacA, dacC, and ampC/peptidyl‑prolyl cis/trans isomerase (trigger factor)
RA 450,333 A→T 6.8% intergenic (+88/‑256) bolA → / → tig stationary‑phase morphogene, transcriptional repressor for mreB; also regulator for dacA, dacC, and ampC/peptidyl‑prolyl cis/trans isomerase (trigger factor)
RA 450,766 G→T 100% A60S (GCG→TCG)  tig → peptidyl‑prolyl cis/trans isomerase (trigger factor)
RA 456,298 T→A 100% L652Q (CTG→CAG)  lon → DNA‑binding ATP‑dependent protease La
RA 456,588 G→T 100% D749Y (GAC→TAC)  lon → DNA‑binding ATP‑dependent protease La
RA 459,325 T→A 22.5% intergenic (+83/‑68) ppiD → / → ybaV periplasmic folding chaperone, has an inactive PPIase domain/putative competence‑suppressing periplasmic helix‑hairpin‑helix DNA‑binding protein
RA 461,499 G→T 100% R424S (CGC→AGC)  ybaE ← putative ABC superfamily transporter periplasmic‑binding protein
RA 463,179 C→A 100% I104I (ATC→ATA cof → thiamine pyrimidine pyrophosphate hydrolase; HMP‑PP phosphatase
RA 469,232 G→T 25.3% E271* (GAA→TAA)  amtB → ammonium transporter
RA 469,775 C→A 29.0% V281V (GTG→GTT tesB ← acyl‑CoA thioesterase 2
RA 474,138 G→T 100% intergenic (‑65/+99) ylaB ← / ← ylaC putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase/DUF1449 family inner membrane protein
RA 475,805 C→A 100% A120A (GCG→GCT tomB ← Hha toxicity attenuator; conjugation‑related protein
RA 477,267 G→T 100% Q865K (CAG→AAG)  acrB ← multidrug efflux system protein
RA 479,244 C→A 100% A206S (GCC→TCC)  acrB ← multidrug efflux system protein
RA 480,820 C→T 100% D86N (GAC→AAC)  acrA ← multidrug efflux system
RA 481,667 G→A 100% A151T (GCG→ACG)  acrR → transcriptional repressor
RA 482,757 G→T 100% A256S (GCG→TCG)  mscK → mechanosensitive channel protein, intermediate conductance, K+ regulated
RA 483,159 G→T 7.1% D390Y (GAT→TAT)  mscK → mechanosensitive channel protein, intermediate conductance, K+ regulated
RA 486,494 C→A 100% R53S (CGC→AGC)  ybaN → DUF454 family inner membrane protein
RA 490,022 C→A 9.9% I54I (ATC→ATA recR → gap repair protein
RA 490,089 C→A 8.8% R77S (CGT→AGT)  recR → gap repair protein
RA 495,020 T→A 100% E137V (GAA→GTA)  aes ← acetyl esterase
RA 496,210 G→T 26.9% M210I (ATG→ATT gsk → inosine/guanosine kinase
RA 500,234 C→A 64.5% intergenic (‑82/‑136) fsr ← / → ushA putative fosmidomycin efflux system protein/bifunctional UDP‑sugar hydrolase/5'‑nucleotidase
RA 503,475 C→A 9.9% W21L (TGG→TTG)  ybaP ← TraB family protein
RA 503,944 G→T 100% E91* (GAA→TAA)  ybaQ → putative DNA‑binding transcriptional regulator
RA 509,737 G→A 100% E97K (GAG→AAG)  cueR → copper‑responsive regulon transcriptional regulator
RA 517,392 G→T 100% A507A (GCG→GCT ybbP → putative ABC transporter permease
RA 517,551 G→T 24.0% P560P (CCG→CCT ybbP → putative ABC transporter permease
RA 518,243 G→T 12.4% R791L (CGA→CTA)  ybbP → putative ABC transporter permease
RA 518,654 G→T 8.2% intergenic (+368/‑63) ybbP → / → rhsD putative ABC transporter permease/Rhs family putative polymorphic toxin
RA 518,820 C→A 100% A35E (GCG→GAG)  rhsD → Rhs family putative polymorphic toxin
RA 524,334:1 +T 100% pseudogene (239/491 nt) ybbD → pseudogene
RA 524,496 T→G 100% pseudogene (401/491 nt) ybbD → pseudogene
RA 524,983 G→T 23.0% pseudogene (28/93 nt) ylbI → pseudogene, Rhs family protein
RA 525,079 A→T 27.5% pseudogene (38/66 nt) ylbG ← pseudogene, DNA‑binding transcriptional regulator homology
RA 525,268 C→A 13.8% pseudogene (205/357 nt) ylbG ← pseudogene, DNA‑binding transcriptional regulator homology
RA 529,211 A→C 8.6% S249R (AGT→CGT)  allR → transcriptional repressor of all and gcl operons; glyoxylate‑induced
RA 530,466 C→A 100% F365L (TTC→TTA gcl → glyoxylate carboligase
RA 535,073 C→A 24.9% I157I (ATC→ATA allB → allantoinase
RA 542,200 Δ1 bp 100% coding (65/1668 nt) fdrA → putative NAD(P)‑binding acyl‑CoA synthetase
RA 542,948 T→A 11.2% I271I (ATT→ATA fdrA → putative NAD(P)‑binding acyl‑CoA synthetase
RA 546,491 G→T 100% V199V (GTG→GTT ybcF → putative carbonate kinase
RA 549,397 G→T 100% intergenic (‑1/+2) lpxH ← / ← ppiB UDP‑2,3‑diacylglucosamine pyrophosphohydrolase/peptidyl‑prolyl cis‑trans isomerase B (rotamase B)
RA 551,499 G→T 100% R171S (CGC→AGC)  ybcI ← DUF457 family inner membrane protein
RA 551,602 A→T 65.8% F136L (TTT→TTA ybcI ← DUF457 family inner membrane protein
RA 555,927 G→T 26.3% D259Y (GAT→TAT)  sfmD → putative outer membrane export usher protein
RA 557,592 G→T 100% D814Y (GAC→TAC)  sfmD → putative outer membrane export usher protein
RA 559,245 G→T 20.5% G154C (GGT→TGT)  sfmF → FimA homolog
RA 571,730 G→T 29.8% pseudogene (552/1040 nt) nmpC ← DLP12 prophage; truncated outer membrane porin (pseudogene);IS, phage, Tn; Phage or Prophage Related; outer membrane porin protein; locus of qsr prophage
RA 572,600 G→A 5.6% intergenic (‑319/‑254) nmpC ← / → essD DLP12 prophage; truncated outer membrane porin (pseudogene);IS, phage, Tn; Phage or Prophage Related; outer membrane porin protein; locus of qsr prophage/DLP12 prophage; putative phage lysis protein
RA 576,192 T→A 10.1% intergenic (‑291/‑98) ylcI ← / → nohD DUF3950 family protein, DLP12 prophage/DLP12 prophage; DNA packaging protein
RA 576,998 G→T 100% pseudogene (189/309 nt) aaaD → pseudogene; DLP12 prophage; tail fiber assembly protein family;Phage or Prophage Related
RA 579,692 G→A 22.6% D186N (GAT→AAT)  appY → global transcriptional activator; DLP12 prophage
RA 580,366 G→T 100% R242S (CGC→AGC)  ompT ← DLP12 prophage; outer membrane protease VII (outer membrane protein 3b)
RA 581,203 A→T 100% intergenic (‑114/‑310) ompT ← / → pauD DLP12 prophage; outer membrane protease VII (outer membrane protein 3b)/tRNA‑OTHER
RA 581,503 G→T 57.5% intergenic (‑414/‑10) ompT ← / → pauD DLP12 prophage; outer membrane protease VII (outer membrane protein 3b)/tRNA‑OTHER
RA 581,633 G→T 60.1% L244L (CTC→CTA envY ← porin thermoregulatory transcriptional activator
RA 582,322 C→A 26.2% E15* (GAA→TAA)  envY ← porin thermoregulatory transcriptional activator
RA 583,341 T→G 100% S33R (AGT→CGT)  ybcH ← PRK09936 family protein
RA 590,565 A→T 5.7% V112E (GTG→GAG)  cusR ← response regulator in two‑component regulatory system with CusS
RA 591,864 C→A 100% A270E (GCG→GAG)  cusC → copper/silver efflux system, outer membrane component
RA 601,847 A→T 100% I331I (ATT→ATA ybdK ← weak gamma‑glutamyl:cysteine ligase
RA 607,931 G→A 100% S7F (TCC→TTC)  fepA ← iron‑enterobactin outer membrane transporter
RA 608,104 G→T 47.2% intergenic (‑154/‑89) fepA ← / → fes iron‑enterobactin outer membrane transporter/enterobactin/ferric enterobactin esterase
RA 608,575 T→A 24.7% L128Q (CTG→CAG)  fes → enterobactin/ferric enterobactin esterase
RA 614,003 T→A 9.1% I98I (ATT→ATA fepE → regulator of length of O‑antigen component of lipopolysaccharide chains
RA 614,726 G→T 100% A339A (GCG→GCT fepE → regulator of length of O‑antigen component of lipopolysaccharide chains
RA 619,048 C→A 100% A307S (GCC→TCC)  fepB ← iron‑enterobactin transporter subunit
RA 620,891 C→T 7.6% P184L (CCG→CTG)  entC → isochorismate synthase 1
RA 624,669 G→T 100% T221T (ACG→ACT entA → 2,3‑dihydro‑2,3‑dihydroxybenzoate dehydrogenase
RA 625,174 G→T 100% intergenic (+5/‑176) entH → / → cstA enterobactin synthesis proofreading thioesterase/carbon starvation protein involved in peptide utilization; APC peptide transporter family protein
RA 625,364 G→T 100% G5G (GGG→GGT cstA → carbon starvation protein involved in peptide utilization; APC peptide transporter family protein
RA 627,428 C→A 100% I693I (ATC→ATA cstA → carbon starvation protein involved in peptide utilization; APC peptide transporter family protein
RA 631,020 G→T 30.2% Q336K (CAG→AAG)  ybdN ← PAPS reductase‑like domain protein
RA 634,078 T→A 26.2% intergenic (‑49/‑323) dsbG ← / → ahpC thiol:disulfide interchange protein, periplasmic/alkyl hydroperoxide reductase, C22 subunit
RA 634,111 G→T 10.5% intergenic (‑82/‑290) dsbG ← / → ahpC thiol:disulfide interchange protein, periplasmic/alkyl hydroperoxide reductase, C22 subunit
RA 639,231 G→A 100% L65F (CTT→TTT)  rnk ← regulator of nucleoside diphosphate kinase
RA 647,234 C→T 100% E27K (GAA→AAA)  citC ← [citrate [pro‑3S]‑lyase] ligase
RA 647,422 G→T 100% intergenic (‑110/‑269) citC ← / → citA [citrate [pro‑3S]‑lyase] ligase/sensory histidine kinase in two‑component regulatory system with CitB
RA 647,509 T→C 100% intergenic (‑197/‑182) citC ← / → citA [citrate [pro‑3S]‑lyase] ligase/sensory histidine kinase in two‑component regulatory system with CitB
RA 648,056 C→A 100% F122L (TTC→TTA citA → sensory histidine kinase in two‑component regulatory system with CitB
RA 652,574 G→T 27.9% intergenic (+1/‑174) pagP → / → cspE phospholipid:lipid A palmitoyltransferase/constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein
RA 652,597 C→T 100% intergenic (+24/‑151) pagP → / → cspE phospholipid:lipid A palmitoyltransferase/constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein
RA 652,865 Δ1 bp 100% coding (118/210 nt) cspE → constitutive cold shock family transcription antitermination protein; negative regulator of cspA transcription; RNA melting protein; ssDNA‑binding protein
RA 658,096 C→A 70.7% M1M (ATG→ATT) † ybeD ← UPF0250 family protein
RA 659,689 G→T 100% R320S (CGC→AGC)  rlpA ← septal ring protein, suppressor of prc, minor lipoprotein
RA 662,108 A→T 100% V522V (GTT→GTA mrdA ← transpeptidase involved in peptidoglycan synthesis (penicillin‑binding protein 2)
RA 662,631 C→A 100% R348L (CGC→CTC)  mrdA ← transpeptidase involved in peptidoglycan synthesis (penicillin‑binding protein 2)
RA 667,174 G→T 16.0% R157S (CGT→AGT)  lptE ← LPS assembly OM complex LptDE, lipoprotein component
RA 667,348 G→T 100% Q99K (CAG→AAG)  lptE ← LPS assembly OM complex LptDE, lipoprotein component
RA 667,899 C→A 100% D781Y (GAT→TAT)  leuS ← leucyl‑tRNA synthetase
RA 672,142 T→A 100% intergenic (‑139/‑25) ybeQ ← / → ybeR Sel1 family TPR‑like repeat protein/uncharacterized protein
RA 676,738 C→A 9.3% F357L (TTC→TTA djlC → J domain‑containing HscC co‑chaperone; Hsc56
RA 680,846 G→T 100% F180L (TTC→TTA gltK ← glutamate, aspartate ABC transporter permease subunit
RA 681,457 G→T 9.4% N223K (AAC→AAA gltJ ← glutamate, aspartate ABC transporter permease subunit
RA 693,739 G→T 100% H299N (CAC→AAC)  asnB ← asparagine synthetase B
RA 700,407 C→A 66.0% N336K (AAC→AAA nagE → fused N‑acetyl glucosamine specific PTS enzyme: IIC, IIB, and IIA components
RA 703,476 C→A 5.9% intergenic (+263/‑314) glnS → / → chiP glutamyl‑tRNA synthetase/chitoporin, uptake of chitosugars
RA 705,588 C→A 100% intergenic (+16/+68) chiQ → / ← fur chitosugar‑induced verified lipoprotein/ferric iron uptake regulon transcriptional repressor; autorepressor
RA 706,097 A→C 100% T2T (ACT→ACG
*29G (TGA→GGA) 
fur ←
uof ←
ferric iron uptake regulon transcriptional repressor; autorepressor
ryhB‑regulated fur leader peptide
RA 707,103 T→A 6.2% L84F (TTA→TTT ybfE ← LexA‑regulated protein, CopB family
RA 710,187 A→T 100% S392C (AGT→TGT)  pgm → phosphoglucomutase
RA 715,686 A→T 24.7% R77R (CGT→CGA speF ← ornithine decarboxylase isozyme, inducible
RA 715,924 C→T 33.8% intergenic (‑8/‑115) speF ← / → ybfK ornithine decarboxylase isozyme, inducible/uncharacterized protein
RA 720,816 G→T 28.0% I559I (ATC→ATA kdpB ← potassium translocating ATPase, subunit B
RA 723,859 G→T 100% V110V (GTC→GTA kdpA ← potassium translocating ATPase, subunit A
RA 724,813 A→T 100% intergenic (+17/‑226) ybfA → / → rhsC DUF2517 family protein/Rhs family putative polymorphic toxin
RA 726,087 G→T 100% R350L (CGT→CTT)  rhsC → Rhs family putative polymorphic toxin
RA 729,456 G→A 100% R75R (AGG→AGA ybfB → putative membrane protein
RA 730,891 G→T 100% pseudogene (1303/1521 nt) rhsO → pseudogene, Rhs family protein
RA 732,494 G→T 100% pseudogene (214/1137 nt) ybfL → pseudogene, DDE domain transposase family;putative factor; Not classified; putative receptor protein
RA 732,655 G→T 100% pseudogene (375/1137 nt) ybfL → pseudogene, DDE domain transposase family;putative factor; Not classified; putative receptor protein
RA 737,635 G→T 100% G126G (GGC→GGA dtpD ← dipeptide and tripeptide permease D
RA 741,536 A→T 5.4% E49V (GAA→GTA)  nei → endonuclease VIII/ 5‑formyluracil/5‑hydroxymethyluracil DNA glycosylase
RA 743,797 G→T 100% R214R (CGC→CGA ybgO ← putative fimbrial protein
RA 745,893 G→A 25.7% S578L (TCG→TTG)  ybgQ ← putative outer membrane protein
RA 746,916 A→T 24.2% F237Y (TTC→TAC)  ybgQ ← putative outer membrane protein
RA 747,068 A→T 68.7% I186I (ATT→ATA ybgQ ← putative outer membrane protein
RA 747,318 T→A 5.7% Q103L (CAG→CTG)  ybgQ ← putative outer membrane protein
RA 747,973 C→A 100% P93P (CCG→CCT ybgD ← putative fimbrial‑like adhesin protein
RA 748,707 A→T 100% I406I (ATT→ATA gltA ← citrate synthase
RA 753,549 G→T 100% Q135H (CAG→CAT sdhB → succinate dehydrogenase, FeS subunit
RA 754,572 G→T 100% E137D (GAG→GAT sucA → 2‑oxoglutarate decarboxylase, thiamine triphosphate‑binding
RA 759,000 C→A 100% F177L (TTC→TTA sucC → succinyl‑CoA synthetase, beta subunit
RA 761,253 C→A 58.6% D27Y (GAT→TAT)  mngR ← Transcriptional repressor for the mannosyl‑D‑glycerate catabolic operon
RA 767,399 A→T 100% E162D (GAA→GAT cydA → cytochrome d terminal oxidase, subunit I
RA 769,423 C→T 27.1% A309V (GCA→GTA)  cydB → cytochrome d terminal oxidase, subunit II
RA 784,094 G→T 100% A67E (GCG→GAG)  galM ← aldose 1‑epimerase; type‑1 mutarotase
RA 788,902 G→T 100% R115S (CGT→AGT)  modF ← fused molybdate transporter subunits of ABC superfamily: ATP‑binding components
RA 793,765 G→T 5.0% I41I (ATC→ATA ybhA ← pyridoxal phosphate (PLP) phosphatase
RA 800,488 G→T 100% V510V (GTG→GTT ybhJ → putative hydratase
RA 800,779 G→T 100% E607D (GAG→GAT ybhJ → putative hydratase
RA 805,678 G→T 70.0% T293T (ACG→ACT bioB → biotin synthase
RA 809,212 G→T 100% M77I (ATG→ATT uvrB → excinulease of nucleotide excision repair, DNA damage recognition component
RA 811,634 A→T 9.3% L157* (TTA→TAA)  ybhK ← putative NAD(P)‑binding transferase
RA 816,302 G→T 100% R18S (AGG→AGT ybhM → UPF0005 family inner membrane protein
RA 819,200 G→T 15.4% H252N (CAT→AAT)  ybhP ← endo/exonuclease/phosphatase family protein
RA 820,503 C→A 100% T354T (ACG→ACT ybhR ← inner membrane putative ABC superfamily transporter permease
RA 823,968 G→T 7.6% P157Q (CCG→CAG)  ybhF ← putative transporter subunit of ABC superfamily: ATP‑binding component
RA 828,374 G→T 100% V11V (GTC→GTA ybiA ← DUF1768 family protein
RA 829,009 G→T 100% D162Y (GAT→TAT)  dinG → ATP‑dependent DNA helicase
RA 832,445 G→T 100% P213P (CCG→CCT ybiC → putative dehydrogenase
RA 837,132 C→T 100% intergenic (‑145/+120) fiu ← / ← mcbA catecholate siderophore receptor Fiu/colanic acid mucoidy stimulation protein
RA 837,716 G→T 100% intergenic (‑204/‑72) mcbA ← / → rlmF colanic acid mucoidy stimulation protein/23S rRNA m(6)A1618 methyltransferase, SAM‑dependent
RA 842,041 C→A 100% E179* (GAA→TAA)  glnP ← glutamine transporter subunit
RA 843,299 C→A 100% W54C (TGG→TGT glnH ← glutamine transporter subunit
RA 847,118 G→T 15.8% I312I (ATC→ATA ybiP ← putative EptAB family phosphoethanolamine transferase, inner membrane protein
RA 850,161 G→T 100% P353P (CCG→CCT ybiR → putative transporter
RA 861,926 C→A 10.2% intergenic (‑106/‑98) moeA ← / → iaaA molybdopterin molybdenumtransferase; molybdopterin biosynthesis protein/Isoaspartyl peptidase
RA 868,500 A→T 100% S22S (TCA→TCT yliE → putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA 872,975 C→A 21.3% E173* (GAA→TAA)  rimO ← ribosomal protein S12 methylthiotransferase; radical SAM superfamily
RA 875,468 C→A 27.1% D157Y (GAC→TAC)  gstB ← glutathione S‑transferase
RA 876,395 G→T 100% M71I (ATG→ATT dacC → D‑alanyl‑D‑alanine carboxypeptidase (penicillin‑binding protein 6a)
RA 876,447 G→A 100% D89N (GAT→AAT)  dacC → D‑alanyl‑D‑alanine carboxypeptidase (penicillin‑binding protein 6a)
RA 879,085 G→T 100% intergenic (‑241/‑44) ybjG ← / → mdfA undecaprenyl pyrophosphate phosphatase/multidrug efflux system protein
RA 879,118 G→A 6.9% intergenic (‑274/‑11) ybjG ← / → mdfA undecaprenyl pyrophosphate phosphatase/multidrug efflux system protein
RA 882,672 G→T 100% L42I (CTC→ATC)  ybjJ ← putative transporter
RA 888,964 C→T 100% intergenic (+75/‑276) ybjN → / → potF negative regulator of motility; multicopy suppressor of coaA(Ts)/putrescine transporter subunit: periplasmic‑binding component of ABC superfamily
RA 892,358 G→T 100% V257L (GTG→TTG)  potH → putrescine transporter subunit: membrane component of ABC superfamily
RA 896,104 G→T 8.7% intergenic (‑73/+218) artJ ← / ← artM arginine binding protein, periplasmic/arginine transporter subunit
RA 899,388 T→G 30.2% intergenic (‑198/+20) artP ← / ← ybjP arginine transporter subunit/lipoprotein
RA 907,893 C→A 26.4% D460Y (GAT→TAT)  hcp ← hybrid‑cluster [4Fe‑2S‑2O] protein in anaerobic terminal reductases
RA 925,160 G→T 100% S420* (TCA→TAA)  cydD ← fused glutathione, cysteine exporter subunits of ABC superfamily: membrane component/ATP‑binding component
RA 929,657 T→C 60.0% A326A (GCT→GCC ftsK → DNA translocase at septal ring sorting daughter chromsomes
RA 942,724 A→T 29.0% N14Y (AAC→TAC)  ycaM → putative transporter
RA 943,573 G→T 100% A297S (GCC→TCC)  ycaM → putative transporter
RA 955,568 A→T 100% intergenic (+17/‑152) aroA → / → ycaL 5‑enolpyruvylshikimate‑3‑phosphate synthetase/putative peptidase‑related chaperone
RA 968,415 G→T 100% S148* (TCG→TAG)  ycbC ← DUF218 superfamily protein
RA 982,574 C→A 23.6% intergenic (‑136/+467) ompF ← / ← asnS outer membrane porin 1a (Ia;b;F)/asparaginyl tRNA synthetase
RA 992,767 C→A 100% D68Y (GAT→TAT)  ssuE ← NAD(P)H‑dependent FMN reductase
RA 994,328 G→T 100% G128V (GGA→GTA)  elfD → putative periplasmic pilin chaperone
RA 997,673 A→T 100% T137T (ACA→ACT elfG → putative fimbrial‑like adhesin protein
RA 997,965 G→T 100% D235Y (GAT→TAT)  elfG → putative fimbrial‑like adhesin protein
RA 1,000,841 G→T 100% A206A (GCG→GCT pyrD → dihydro‑orotate oxidase, FMN‑linked
RA 1,003,597 G→T 100% D100Y (GAC→TAC)  rlmL → fused 23S rRNA m(2)G2445 and m(7)G2069 methyltransferase, SAM‑dependent
RA 1,011,929 T→A 100% intergenic (‑3/+66) fabA ← / ← ycbZ beta‑hydroxydecanoyl thioester dehydrase/putative peptidase
RA 1,024,003 C→A 15.7% D59Y (GAT→TAT)  hspQ ← heat shock protein involved in degradation of mutant DnaA; hemimethylated oriC DNA‑binding protein
RA 1,024,703 G→T 100% G241G (GGC→GGA rlmI ← 23S rRNA m(5)C1962 methyltransferase, SAM‑dependent
RA 1,038,316 G→T 100% R451S (CGT→AGT)  etk ← tyrosine‑protein kinase, role in O‑antigen capsule formation
RA 1,048,928 C→A 100% E903* (GAA→TAA)  torS ← hybrid sensory histidine kinase in two‑component regulatory system with TorR
RA 1,049,407 G→T 100% T743K (ACG→AAG)  torS ← hybrid sensory histidine kinase in two‑component regulatory system with TorR
RA 1,052,229 G→T 13.3% L171F (TTG→TTT torT → periplasmic sensory protein associated with the TorRS two‑component regulatory system
RA 1,055,132 G→T 100% E141* (GAA→TAA)  torA → trimethylamine N‑oxide (TMAO) reductase I, catalytic subunit
RA 1,057,226 G→T 24.3% E839* (GAA→TAA)  torA → trimethylamine N‑oxide (TMAO) reductase I, catalytic subunit
RA 1,058,131 G→T 67.3% H61N (CAT→AAT)  cbpM ← modulator of CbpA co‑chaperone
RA 1,067,754 T→A 38.9% H189L (CAC→CTC)  rutB ← ureidoacrylate amidohydrolase
RA 1,077,911 A→C 100% K71N (AAA→AAC efeO → inactive ferrous ion transporter EfeUOB
RA 1,083,443 G→T 100% S624* (TCG→TAG)  pgaB ← poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine (PGA) N‑deacetylase outer membrane export lipoprotein
RA 1,084,103 A→T 100% L404* (TTA→TAA)  pgaB ← poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine (PGA) N‑deacetylase outer membrane export lipoprotein
RA 1,097,943 T→A 66.5% N19Y (AAT→TAT)  csgE ← curlin secretion specificity factor
RA 1,101,777 G→T 61.7% E168* (GAA→TAA)  ymdB → O‑acetyl‑ADP‑ribose deacetylase; RNase III inhibitor during cold shock; putative cardiolipin synthase C regulatory subunit
RA 1,103,665 G→T 18.6% R245S (CGT→AGT)  opgC ← osmoregulated periplasmic glucan succinylation membrane protein
RA 1,103,695 G→T 5.7% H235N (CAT→AAT)  opgC ← osmoregulated periplasmic glucan succinylation membrane protein
RA 1,103,899 A→T 20.4% S167T (TCT→ACT)  opgC ← osmoregulated periplasmic glucan succinylation membrane protein
RA 1,104,639 C→A 100% intergenic (‑242/‑152) opgC ← / → opgG osmoregulated periplasmic glucan succinylation membrane protein/osmoregulated periplasmic glucan (OPG) biosynthesis periplasmic protein
RA 1,106,503 C→A 17.0% S62* (TCA→TAA)  opgH → membrane glycosyltransferase; nutrient‑dependent cell size regulator, FtsZ assembly antagonist
RA 1,113,450 A→T 100% I161I (ATT→ATA yceI ← secreted protein
RA 1,114,329 C→A 100% L58F (TTG→TTT yceJ ← putative cytochrome b561
RA 1,116,548 T→A 100% intergenic (‑137/+150) bssS ← / ← dinI biofilm regulator/DNA damage‑inducible protein I
RA 1,116,964 A→G 100% intergenic (‑21/+53) dinI ← / ← pyrC DNA damage‑inducible protein I/dihydro‑orotase
RA 1,118,506 A→T 7.8% L75Q (CTA→CAA)  yceB ← lipoprotein, DUF1439 family
RA 1,118,591 C→A 66.2% G47C (GGT→TGT)  yceB ← lipoprotein, DUF1439 family
RA 1,122,429 G→T 12.6% S56S (TCG→TCT yceM → putative oxidoreductase
RA 1,122,994 C→A 100% R245S (CGC→AGC)  yceM → putative oxidoreductase
RA 1,128,764 C→A 28.8% I245I (ATC→ATA flgE → flagellar hook protein
RA 1,129,972 G→T 27.4% D239Y (GAT→TAT)  flgF → flagellar component of cell‑proximal portion of basal‑body rod
RA 1,131,521 C→A 100% Q168K (CAG→AAG)  flgH → flagellar protein of basal‑body outer‑membrane L ring
RA 1,133,311 T→A 26.9% L162Q (CTG→CAG)  flgJ → flagellar rod assembly protein and murein hydrolase; flagellum‑specific muramidase
RA 1,137,384 G→T 100% R814S (CGC→AGC)  rne ← fused ribonucleaseE: endoribonuclease/RNA‑binding protein/RNA degradosome binding protein
RA 1,139,402 C→A 100% R141L (CGC→CTC)  rne ← fused ribonucleaseE: endoribonuclease/RNA‑binding protein/RNA degradosome binding protein
RA 1,140,834 A→T 63.0% T147S (ACC→TCC)  rluC → 23S rRNA pseudouridine(955,2504,2580) synthase
RA 1,146,692 A→T 100% T189T (ACA→ACT fabG → 3‑oxoacyl‑[acyl‑carrier‑protein] reductase
RA 1,147,364 G→T 57.1% intergenic (+57/‑31) acpP → / → fabF acyl carrier protein (ACP)/3‑oxoacyl‑[acyl‑carrier‑protein] synthase II
RA 1,151,750 G→T 100% R178L (CGC→CTC)  holB → DNA polymerase III, delta prime subunit
RA 1,152,278 G→T 100% E16* (GAA→TAA)  ycfH → putative DNase
RA 1,153,214 T→C 30.3% intergenic (+184/‑111) ycfH → / → ptsG putative DNase/fused glucose‑specific PTS enzymes: IIB component/IIC component
RA 1,156,310 G→T 100% S233* (TCA→TAA)  fhuE ← ferric‑rhodotorulic acid outer membrane transporter
RA 1,163,251 A→T 5.2% Q66L (CAG→CTG)  ycfJ → uncharacterized protein
RA 1,169,139 G→T 7.6% T94T (ACC→ACA mfd ← transcription‑repair coupling factor
RA 1,181,504 G→T 100% D69Y (GAT→TAT)  pepT → peptidase T
RA 1,191,280 G→T 30.7% M234I (ATG→ATT icd → e14 prophage; isocitrate dehydrogenase, specific for NADP+
RA 1,191,676 C→T 100% H366H (CAC→CAT icd → e14 prophage; isocitrate dehydrogenase, specific for NADP+
RA 1,207,417 C→A 28.7% G15C (GGT→TGT)  iraM ← RpoS stabilzer during Mg starvation, anti‑RssB factor
RA 1,207,958 G→T 5.6% intergenic (‑499/+201) iraM ← / ← ycgX RpoS stabilzer during Mg starvation, anti‑RssB factor/DUF1398 family protein
RA 1,211,169 C→A 100% intergenic (‑238/‑76) bluF ← / → ycgZ anti‑repressor for YcgE, blue light‑responsive; FAD‑binding; has c‑di‑GMP phosphodiesterase‑like EAL domain, but does not degrade c‑di‑GMP/RcsB connector protein for regulation of biofilm and acid‑resistance
RA 1,214,055 T→A 27.5% I424I (ATT→ATA ycgG → putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA 1,218,601 T→A 32.8% K7* (AAG→TAG)  ymgI ← uncharacterized protein
RA 1,219,533 A→G 100% intergenic (+170/+202) ycgI → / ← minE pseudogene/cell division topological specificity factor
RA 1,220,996 G→T 100% R181R (CGG→AGG)  minC ← cell division inhibitor
RA 1,224,292 G→A 100% D8N (GAT→AAT)  ycgN → UPF0153 family cysteine cluster protein
RA 1,226,292 T→A 100% C24S (TGT→AGT)  umuD → DNA polymerase V, subunit D
RA 1,228,591 G→T 100% intergenic (‑105/+41) dsbB ← / ← nhaB oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I/sodium:proton antiporter
RA 1,241,397 T→A 24.6% H479L (CAC→CTC)  treA ← periplasmic trehalase
RA 1,245,611 G→T 60.5% F228L (TTC→TTA dhaK ← dihydroxyacetone kinase, PTS‑dependent, dihydroxyacetone‑binding subunit
RA 1,249,227 G→T 100% R728S (CGT→AGT)  ycgV ← putative adhesin
RA 1,249,716 G→T 61.7% R565S (CGC→AGC)  ycgV ← putative adhesin
RA 1,255,258 A→T 11.7% A334A (GCT→GCA dauA ← C4‑dicarboxylic acid transporter
RA 1,257,232 G→T 100% R34S (CGC→AGC)  prs ← phosphoribosylpyrophosphate synthase
RA 1,261,810 G→A 100% A87A (GCG→GCA prmC → N5‑glutamine methyltransferase, modifies release factors RF‑1 and RF‑2
RA 1,264,442 G→T 100% V274V (GTG→GTT kdsA → 3‑deoxy‑D‑manno‑octulosonate 8‑phosphate synthase
RA 1,276,971 T→A 5.1% L551H (CTC→CAC)  narG → nitrate reductase 1, alpha subunit
RA 1,277,786 G→A 100% D823N (GAC→AAC)  narG → nitrate reductase 1, alpha subunit
RA 1,281,042 C→A 27.1% R150S (CGT→AGT)  narJ → molybdenum‑cofactor‑assembly chaperone subunit (delta subunit) of nitrate reductase 1
RA 1,281,517 G→T 7.7% L71L (CTG→CTT narI → nitrate reductase 1, gamma (cytochrome b(NR)) subunit
RA 1,282,421 A→T 16.8% intergenic (+439/+101) narI → / ← rttR nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
RA 1,284,857 G→T 69.6% D53Y (GAT→TAT)  rssA → putative patatin‑like family phospholipase
RA 1,288,669 A→T 100% intergenic (‑291/‑314) hns ← / → tdk global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase
RA 1,288,739 C→A 7.3% intergenic (‑361/‑244) hns ← / → tdk global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase
RA 1,289,975 G→T 10.2% pseudogene (474/567 nt) insZ ← pseudogene, transposase homolog
RA 1,290,033 G→T 100% pseudogene (416/567 nt) insZ ← pseudogene, transposase homolog
RA 1,290,222 T→A 5.4% pseudogene (227/567 nt) insZ ← pseudogene, transposase homolog
RA 1,293,952 G→A 19.5% intergenic (‑375/‑102) adhE ← / → ychE fused acetaldehyde‑CoA dehydrogenase/iron‑dependent alcohol dehydrogenase/pyruvate‑formate lyase deactivase/UPF0056 family inner membrane protein
RA 1,295,079 C→T 6.1% intergenic (+378/‑360) ychE → / → oppA UPF0056 family inner membrane protein/oligopeptide transporter subunit
RA 1,296,729 C→A 100% H431N (CAC→AAC)  oppA → oligopeptide transporter subunit
RA 1,308,862 A→C 6.6% S196R (AGC→CGC)  ompW → outer membrane protein W
RA 1,318,228 C→A 69.3% S251* (TCA→TAA)  yciV → PHP domain protein
RA 1,318,829 G→T 61.8% E159* (GAA→TAA)  yciO → putative RNA binding protein
RA 1,322,140 T→A 100% T159S (ACG→TCG)  btuR ← cob(I)yrinic acid a,c‑diamide adenosyltransferase
RA 1,325,982 G→T 100% T226T (ACG→ACT topA → DNA topoisomerase I, omega subunit
RA 1,326,726 A→T 27.2% P474P (CCA→CCT topA → DNA topoisomerase I, omega subunit
RA 1,328,313 C→A 30.1% R68S (CGT→AGT)  cysB → N‑acetylserine‑responsive cysteine regulon transcriptional activator; autorepressor
RA 1,330,955 G→T 100% D290Y (GAT→TAT)  acnA → aconitate hydratase 1
RA 1,331,654 G→T 31.1% D523Y (GAT→TAT)  acnA → aconitate hydratase 1
RA 1,334,046 G→T 6.4% E154* (GAG→TAG)  pgpB → phosphatidylglycerophosphatase B
RA 1,334,992 G→T 8.8% D60Y (GAT→TAT)  yciM → envelope integrity maintenance protein; EnvC‑interacting protein
RA 1,335,356 A→T 100% H181L (CAT→CTT)  yciM → envelope integrity maintenance protein; EnvC‑interacting protein
RA 1,336,599 T→C 9.9% L141P (CTT→CCT)  pyrF → orotidine‑5'‑phosphate decarboxylase
RA 1,337,533 G→T 100% A18E (GCA→GAA)  osmB ← lipoprotein
RA 1,341,886 T→A 27.1% A428A (GCA→GCT rnb ← ribonuclease II
RA 1,345,484 A→C 8.0% intergenic (‑188/+180) fabI ← / ← ycjD enoyl‑[acyl‑carrier‑protein] reductase, NADH‑dependent/DUF559 family endonuclease‑related protein
RA 1,348,772 G→T 100% P2T (CCT→ACT) 
A319D (GCC→GAC) 
sapC ←
sapB ←
antimicrobial peptide transport ABC transporter permease
antimicrobial peptide transport ABC transporter permease
RA 1,350,891 G→T 100% S159R (AGC→AGA sapA ← antimicrobial peptide transport ABC transporter periplasmic binding protein
RA 1,351,022 G→T 100% R116S (CGT→AGT)  sapA ← antimicrobial peptide transport ABC transporter periplasmic binding protein
RA 1,358,855 G→T 100% G123C (GGC→TGC)  puuB → gamma‑glutamylputrescine oxidoreductase
RA 1,362,065 G→T 5.3% I35I (ATC→ATA pspF ← psp operon transcriptional activator
RA 1,364,366 G→A 57.4% intergenic (+106/‑107) pspE → / → ycjM thiosulfate:cyanide sulfurtransferase (rhodanese)/alpha amylase catalytic domain family protein
RA 1,365,283 G→T 100% E271* (GAG→TAG)  ycjM → alpha amylase catalytic domain family protein
RA 1,367,252 G→T 26.9% E363* (GAA→TAA)  ycjN → putative ABC superfamily sugar transporter periplasmic‑binding protein
JC JC 1,376,043 IS5 (–) +4 bp 100% pseudogene (10‑13/126 nt) ycjV → pseudogene; putative ATP‑binding component of a transport system
RA 1,377,394 C→T 100% A275A (GCG→GCA ycjW ← LacI family putative transcriptional repressor
RA 1,378,237 G→T 26.0% intergenic (‑19/‑137) ycjW ← / → ycjX LacI family putative transcriptional repressor/DUF463 family protein, putative P‑loop NTPase
RA 1,381,373 A→C 20.0% N133H (AAT→CAT)  tyrR → aromatic amino acid biosynthesis and transport regulon transcriptional regulator; autorepressor; ATPase; phosphatase
RA 1,385,964 T→G 14.0% Q49H (CAA→CAC ycjY ← S9 homolog non‑peptidase family protein
RA 1,386,008 G→T 100% Q35K (CAG→AAG)  ycjY ← S9 homolog non‑peptidase family protein
RA 1,388,406 G→T 100% R308L (CGC→CTC)  mppA → murein tripeptide (L‑ala‑gamma‑D‑glutamyl‑meso‑DAP) transporter subunit
RA 1,389,852 G→T 100% R110S (CGC→AGC)  ynaI ← mechanosensitive channel protein, very small conductance
RA 1,394,355 G→T 25.7% R47S (CGC→AGC)  ogt ← O‑6‑alkylguanine‑DNA:cysteine‑protein methyltransferase
RA 1,397,366 A→T 29.4% S49S (TCT→TCA abgB ← p‑aminobenzoyl‑glutamate hydrolase, B subunit
RA 1,401,341 C→A 7.1% D238Y (GAT→TAT)  ydaM ← diguanylate cyclase, csgD regulator
RA 1,407,139 A→T 27.8% C118* (TGT→TGA intR ← Rac prophage; integrase
RA 1,412,385 G→T 100% N34K (AAC→AAA kilR ← Rac prophage; inhibitor of ftsZ, killing protein
RA 1,421,685 T→A 12.0% pseudogene (40/210 nt) lomR → pseudogene, Rac prophage lom homolog;Phage or Prophage Related; interrupted by IS5 and N‑ter deletion
RA 1,423,872 T→G 7.6% A189A (GCT→GCG stfR → Rac prophage; putative tail fiber protein
RA 1,424,234 C→A 100% S310* (TCA→TAA)  stfR → Rac prophage; putative tail fiber protein
RA 1,428,220 A→G 8.8% intergenic (‑289/+28) pinR ← / ← ynaE Rac prophage; putative site‑specific recombinase/cold shock protein, Rac prophage
JC JC 1,428,894 IS2 (–) +5 bp 100% intergenic (‑413/+317) ynaE ← / ← ttcC cold shock protein, Rac prophage/pseudogene, prophage Rac integration site ttcA duplication;Phage or Prophage Related
RA 1,430,873 G→T 100% S93* (TCA→TAA)  ompN ← outer membrane pore protein N, non‑specific
RA 1,437,184 G→T 29.5% intergenic (‑84/‑124) ldhA ← / → ydbH fermentative D‑lactate dehydrogenase, NAD‑dependent/putative membrane‑anchored protein, function unknown
RA 1,439,518 C→A 100% S737S (TCC→TCA ydbH → putative membrane‑anchored protein, function unknown
RA 1,441,941 G→T 11.7% E56* (GAA→TAA)  feaB → phenylacetaldehyde dehydrogenase
RA 1,442,008 G→T 12.9% R78L (CGA→CTA)  feaB → phenylacetaldehyde dehydrogenase
RA 1,451,422 A→T 100% T246S (ACG→TCG)  paaE → ring 1,2‑phenylacetyl‑CoA epoxidase, NAD(P)H oxidoreductase component
RA 1,454,724 G→T 100% G472C (GGT→TGT)  paaH → 3‑hydroxyadipyl‑CoA dehydrogenase, NAD+‑dependent
RA 1,457,725 G→T 100% intergenic (+30/‑71) paaK → / → paaX phenylacetyl‑CoA ligase/transcriptional repressor of phenylacetic acid degradation paa operon, phenylacetyl‑CoA inducer
RA 1,460,747 A→T 6.9% pseudogene (1099/2513 nt) ydbA → pseudogene, autotransporter homolog; interrupted by IS2 and IS30
RA 1,461,041 A→T 100% pseudogene (1393/2513 nt) ydbA → pseudogene, autotransporter homolog; interrupted by IS2 and IS30
RA 1,461,872 G→T 60.9% pseudogene (2224/2513 nt) ydbA → pseudogene, autotransporter homolog; interrupted by IS2 and IS30
RA 1,470,453 C→A 26.4% V351V (GTC→GTA ydbD → PF10971 family putative periplasmic methylglyoxal resistance protein
RA 1,477,565 A→T 68.9% K83I (AAA→ATA)  hrpA → putative ATP‑dependent helicase
RA 1,478,971 G→A 100% E552K (GAG→AAG)  hrpA → putative ATP‑dependent helicase
RA 1,479,733 G→T 100% D806Y (GAT→TAT)  hrpA → putative ATP‑dependent helicase
RA 1,482,005 G→T 100% D172Y (GAT→TAT)  ydcF → DUF218 superfamily protein, SAM‑binding
RA 1,483,460 G→T 24.9% A324A (GCG→GCT aldA → aldehyde dehydrogenase A, NAD‑linked
RA 1,489,422 T→A 7.1% intergenic (‑94/‑123) ydcI ← / → ydcJ putative DNA‑binding transcriptional regulator/putative metalloenzyme
RA 1,502,848 T→A 10.3% V604E (GTA→GAA)  ydcP → putative peptidase
RA 1,503,262 G→T 26.4% L20L (CTC→CTA yncJ ← uncharacterized protein
RA 1,508,681 C→A 100% F198L (TTC→TTA ydcU → putative spermidine/putrescine transporter subunit
RA 1,510,854 G→T 71.5% A340A (GCG→GCT patD → gamma‑aminobutyraldehyde dehydrogenase
RA 1,510,923 G→T 24.9% T363T (ACG→ACT patD → gamma‑aminobutyraldehyde dehydrogenase
RA 1,512,106 G→T 52.5% E68* (GAA→TAA)  ydcY → uncharacterized protein
RA 1,514,177 G→T 100% E298D (GAG→GAT curA → curcumin/dihydrocurcumin reductase, NADPH‑dependent
RA 1,514,858 G→A 100% E114K (GAA→AAA)  mcbR → colanic acid and biofilm gene transcriptional regulator, MqsR‑controlled
RA 1,519,349 T→A 100% K297* (AAA→TAA)  ansP ← L‑asparagine transporter
RA 1,522,007 C→A 30.9% intergenic (+598/‑152) yncH → / → rhsE IPR020099 family protein/pseudogene, Rhs family protein
RA 1,522,387 C→A 100% pseudogene (229/2037 nt) rhsE → pseudogene, Rhs family protein
RA 1,523,317 G→T 100% pseudogene (1159/2037 nt) rhsE → pseudogene, Rhs family protein
RA 1,523,802 T→G 66.9% pseudogene (1644/2037 nt) rhsE → pseudogene, Rhs family protein
RA 1,526,607 G→A 100% D179N (GAT→AAT)  ydcC → H repeat‑associated putative transposase
RA 1,531,029 G→T 100% R180S (CGC→AGC)  narW ← nitrate reductase 2 (NRZ), delta subunit (assembly subunit)
RA 1,534,409 G→T 100% V813V (GTC→GTA narZ ← nitrate reductase 2 (NRZ), alpha subunit
RA 1,537,806 A→T 100% L171* (TTA→TAA)  narU ← nitrate/nitrite transporter
RA 1,539,827 C→A 100% pseudogene (145/951 nt) yddK ← pseudogene, leucine‑rich protein; putative glycoportein
RA 1,540,399 A→G 69.6% intergenic (‑114/+146) yddL ← / ← yddG putative lipoprotein;putative membrane; Not classified; putative outer membrane porin protein/aromatic amino acid exporter
RA 1,542,503 G→T 32.5% T282T (ACG→ACT fdnG → formate dehydrogenase‑N, alpha subunit, nitrate‑inducible
RA 1,544,432 G→T 25.0% T925T (ACG→ACT fdnG → formate dehydrogenase‑N, alpha subunit, nitrate‑inducible
RA 1,548,144 G→T 100% intergenic (‑49/+85) adhP ← / ← maeA ethanol‑active dehydrogenase/acetaldehyde‑active reductase/malate dehydrogenase, (decarboxylating, NAD‑requiring) (malic enzyme)
RA 1,548,216 A→T 100% intergenic (‑121/+13) adhP ← / ← maeA ethanol‑active dehydrogenase/acetaldehyde‑active reductase/malate dehydrogenase, (decarboxylating, NAD‑requiring) (malic enzyme)
RA 1,551,620 C→A 70.0% D226Y (GAC→TAC)  ddpF ← D,D‑dipeptide permease system, ATP‑binding component
RA 1,552,629 C→A 100% D216Y (GAT→TAT)  ddpD ← D,D‑dipeptide permease system, ATP‑binding component
RA 1,552,648 C→A 23.7% A209A (GCG→GCT ddpD ← D,D‑dipeptide permease system, ATP‑binding component
RA 1,557,390 G→T 11.0% intergenic (‑57/+201) ddpX ← / ← dosP D‑ala‑D‑ala dipeptidase, Zn‑dependent/oxygen sensor, c‑di‑GMP phosphodiesterase, heme‑regulated; cold‑ and stationary phase‑induced bioflim regulator
RA 1,558,685 G→T 100% R436S (CGC→AGC)  dosP ← oxygen sensor, c‑di‑GMP phosphodiesterase, heme‑regulated; cold‑ and stationary phase‑induced bioflim regulator
RA 1,559,507 T→A 73.9% N162Y (AAT→TAT)  dosP ← oxygen sensor, c‑di‑GMP phosphodiesterase, heme‑regulated; cold‑ and stationary phase‑induced bioflim regulator
RA 1,563,276 G→T 100% H491N (CAC→AAC)  gadC ← glutamate:gamma‑aminobutyric acid antiporter
RA 1,565,497 G→A 100% S269L (TCG→TTG)  gadB ← glutamate decarboxylase B, PLP‑dependent
RA 1,569,502 T→G 100% intergenic (‑43/+2) pqqL ← / ← yddB putative periplasmic M16 family zinc metalloendopeptidase/putative TonB‑dependent outer membrane receptor
RA 1,570,428 G→T 100% I483I (ATC→ATA yddB ← putative TonB‑dependent outer membrane receptor
RA 1,570,472 C→A 5.8% G469C (GGC→TGC)  yddB ← putative TonB‑dependent outer membrane receptor
RA 1,570,826 C→A 100% D351Y (GAC→TAC)  yddB ← putative TonB‑dependent outer membrane receptor
RA 1,571,658 C→A 25.8% A73A (GCG→GCT yddB ← putative TonB‑dependent outer membrane receptor
RA 1,572,026 A→T 30.5% L525* (TTA→TAA)  yddA ← putative multidrug transporter subunit of ABC superfamily, membrane component/ATP‑binding component
RA 1,574,523 T→A 100% L175F (TTA→TTT ydeM ← putative YdeN‑specific sulfatase‑maturating enzyme
RA 1,575,339 G→T 100% F481L (TTC→TTA ydeN ← putative Ser‑type periplasmic non‑aryl sulfatase
RA 1,576,325 T→A 100% N153Y (AAT→TAT)  ydeN ← putative Ser‑type periplasmic non‑aryl sulfatase
RA 1,576,932 T→C 8.9% intergenic (‑151/+251) ydeN ← / ← ydeO putative Ser‑type periplasmic non‑aryl sulfatase/UV‑inducible global regulator, EvgA‑, GadE‑dependent
RA 1,580,852 C→A 100% intergenic (‑109/+225) ydeP ← / ← ydeQ putative oxidoreductase/putative fimbrial‑like adhesin protein
RA 1,586,743 A→T 8.7% intergenic (‑44/+179) hipB ← / ← yneO antitoxin of HipAB toxin‑antitoxin system/pseudogene, AidA homolog
RA 1,586,871 G→T 100% intergenic (‑172/+51) hipB ← / ← yneO antitoxin of HipAB toxin‑antitoxin system/pseudogene, AidA homolog
RA 1,586,960 C→A 15.2% pseudogene (5285/5323 nt) yneO ← pseudogene, AidA homolog
RA 1,590,878 A→T 100% pseudogene (1367/5323 nt) yneO ← pseudogene, AidA homolog
RA 1,601,871 C→A 31.5% P90Q (CCG→CAG)  tam → trans‑aconitate methyltransferase
RA 1,602,054 A→T 17.3% Y151F (TAC→TTC)  tam → trans‑aconitate methyltransferase
RA 1,603,440 G→A 100% intergenic (‑161/+46) yneE ← / ← uxaB bestrophin family putative inner membrane protein/altronate oxidoreductase, NAD‑dependent
RA 1,606,775 T→A 9.2% Q245L (CAG→CTG)  glsB ← glutaminase 2
RA 1,613,895 T→A 25.4% L22Q (CTG→CAG)  marA → multiple antibiotic resistance transcriptional regulator
RA 1,614,089 G→T 100% E87* (GAG→TAG)  marA → multiple antibiotic resistance transcriptional regulator
RA 1,614,837 G→T 74.6% I186I (ATC→ATA eamA ← cysteine and O‑acetyl‑L‑serine efflux system
RA 1,615,694 C→A 14.6% R36S (CGC→AGC)  ydeE → putative transporter
RA 1,620,227 C→A 7.8% E471* (GAA→TAA)  dcp ← dipeptidyl carboxypeptidase II
RA 1,620,961 T→G 100% Q226P (CAA→CCA)  dcp ← dipeptidyl carboxypeptidase II
RA 1,621,733 T→A 26.0% intergenic (‑96/‑41) dcp ← / → ydfG dipeptidyl carboxypeptidase II/NADP‑dependent 3‑hydroxy acid dehydrogenase; malonic semialdehyde reductase
RA 1,628,207 G→A 100% G110E (GGA→GAA)  pinQ → Qin prophage; putative site‑specific recombinase
RA 1,631,894 C→T 11.8% S49N (AGC→AAC)  gnsB ← Qin prophage; multicopy suppressor of secG(Cs) and fabA6(Ts)
RA 1,637,458 G→T 11.7% S14Y (TCT→TAT)  quuQ ← Qin prophage; putative antitermination protein Q
RA 1,641,167 A→T 62.5% intergenic (+173/+264) flxA → / ← intK Qin prophage; uncharacterized protein/pseudogene, integrase fragment, Qin prophage;Phage or Prophage Related
RA 1,642,051 T→G 29.6% A19A (GCA→GCC dicC ← Qin prophage; DNA‑binding transcriptional regulator for DicB
RA 1,642,135 C→T 100% intergenic (‑28/‑56) dicC ← / → dicA Qin prophage; DNA‑binding transcriptional regulator for DicB/Qin prophage; putative regulator for DicB
RA 1,642,639 G→T 28.8% intergenic (+41/‑126) dicA → / → ydfA Qin prophage; putative regulator for DicB/Qin prophage; uncharacterized protein
RA 1,643,955 C→A 74.0% A30A (GCC→GCA dicB → Qin prophage; cell division inhibition protein
RA 1,646,372 C→A 100% pseudogene (565/1158 nt) intQ → pseudogene, Qin prophage; phage integrase family;Phage or Prophage Related
RA 1,649,465 T→C 5.3% intergenic (‑67/+139) rspA ← / ← ynfA bifunctional D‑altronate/D‑mannonate dehydratase/UPF0060 family inner membrane protein
RA 1,655,286 A→T 13.8% V158V (GTA→GTT ynfF → S‑ and N‑oxide reductase, A subunit, periplasmic
RA 1,659,446 T→C 8.9% intergenic (+69/‑126) dmsD → / → clcB twin‑argninine leader‑binding protein for DmsA and TorA/H(+)/Cl(‑) exchange transporter
RA 1,659,882 C→A 63.1% S104* (TCG→TAG)  clcB → H(+)/Cl(‑) exchange transporter
RA 1,661,763 C→A 100% P353P (CCG→CCT mlc ← glucosamine anaerobic growth regulon transcriptional repressor; autorepressor
RA 1,666,805 A→C 64.2% S197R (AGT→CGT)  ydgD → putative peptidase
RA 1,669,413 G→T 11.2% P402Q (CCG→CAG)  pntB ← pyridine nucleotide transhydrogenase, beta subunit
RA 1,669,592 G→T 100% F342L (TTC→TTA pntB ← pyridine nucleotide transhydrogenase, beta subunit
RA 1,672,692 T→A 7.8% L3L (CTT→CTA ydgH → DUF1471 family periplasmic protein
RA 1,672,843 A→T 7.4% K54* (AAA→TAA)  ydgH → DUF1471 family periplasmic protein
RA 1,675,261 T→A 6.8% L10* (TTA→TAA)  folM → dihydromonapterin reductase, NADPH‑dependent; dihydrofolate reductase isozyme
RA 1,680,642 C→A 100% E68D (GAG→GAT fumC ← fumarate hydratase (fumarase C),aerobic Class II
RA 1,683,582 C→A 27.5% F250L (TTC→TTA manA → mannose‑6‑phosphate isomerase
RA 1,684,105 C→A 100% intergenic (+97/‑4) manA → / → ydgA mannose‑6‑phosphate isomerase/DUF945 family protein
RA 1,687,003 T→A 26.2% R36* (AGA→TGA)  uidC ← putative outer membrane porin for beta‑glucuronides porin protein
RA 1,688,819 C→A 28.4% E504* (GAA→TAA)  uidA ← beta‑D‑glucuronidase
RA 1,689,180 T→G 100% E383D (GAA→GAC uidA ← beta‑D‑glucuronidase
RA 1,692,573 C→A 100% D289Y (GAT→TAT)  malI ← transcriptional repressor of Mal regulon
RA 1,696,612 A→T 100% E41D (GAA→GAT add → adenosine deaminase
RA 1,699,862 T→A 100% L119* (TTG→TAG)  ydgK → DUF2569 family inner membrane protein
RA 1,700,008 T→A 25.4% intergenic (+61/‑16) ydgK → / → rsxA DUF2569 family inner membrane protein/SoxR iron‑sulfur cluster reduction factor component; inner membrane protein of electron transport complex
RA 1,702,966 T→A 8.3% R597R (CGT→CGA rsxC → SoxR iron‑sulfur cluster reduction factor component; putative membrane‑associated NADH oxidoreductase of electron transport complex
RA 1,703,062 T→A 10.0% R629R (CGT→CGA rsxC → SoxR iron‑sulfur cluster reduction factor component; putative membrane‑associated NADH oxidoreductase of electron transport complex
RA 1,703,071 A→T 11.2% A632A (GCA→GCT rsxC → SoxR iron‑sulfur cluster reduction factor component; putative membrane‑associated NADH oxidoreductase of electron transport complex
RA 1,703,101 C→G 11.7% A642A (GCC→GCG rsxC → SoxR iron‑sulfur cluster reduction factor component; putative membrane‑associated NADH oxidoreductase of electron transport complex
RA 1,703,104 G→A 6.3% E643E (GAG→GAA rsxC → SoxR iron‑sulfur cluster reduction factor component; putative membrane‑associated NADH oxidoreductase of electron transport complex
RA 1,710,635 T→A 11.3% E282V (GAG→GTG)  tyrS ← tyrosyl‑tRNA synthetase
RA 1,711,397 C→T 100% R28Q (CGA→CAA)  tyrS ← tyrosyl‑tRNA synthetase
RA 1,712,562 C→A 75.9% D31Y (GAT→TAT)  mliC ← inhibitor of c‑type lysozyme, membrane‑bound; putative lipoprotein
RA 1,715,383 C→A 28.7% F34L (TTC→TTA ydhI → DUF1656 family putative inner membrane efflux pump associated protein
RA 1,717,809 G→A 55.1% V478I (GTC→ATC)  ydhK → putative efflux protein (PET) component of YdhJK efflux pump
RA 1,718,414 A→T 59.4% Y167N (TAT→AAT)  sodC ← superoxide dismutase, Cu, Zn, periplasmic
RA 1,720,180 C→A 11.1% intergenic (‑3/‑100) ydhL ← / → nemR DUF1289 family protein/transcriptional repressor for the nemRA‑gloA operon, quinone‑, glyoxal‑, and HOCl‑activated
RA 1,723,809 G→T 100% E156* (GAA→TAA)  lhr → putative ATP‑dependent helicase
RA 1,729,371 T→A 8.7% V227E (GTG→GAG)  mepH → murein DD‑endopeptidase, space‑maker hydrolase
RA 1,731,596 C→A 32.2% intergenic (‑49/+117) ydhP ← / ← ynhF putative transporter/stress response membrane
RA 1,733,201 A→C 6.0% L285L (CTT→CTG ydhB ← LysR family putative transcriptional regulator
RA 1,735,082 G→T 60.0% V305V (GTG→GTT ydhC → putative arabinose efflux transporter
RA 1,739,015 T→A 60.9% I434I (ATT→ATA mdtK → multidrug efflux system transporter
RA 1,745,619 C→A 12.3% V121V (GTG→GTT ydhW ← FNR, Nar, NarP‑regulated protein; putative subunit of YdhYVWXUT oxidoreductase complex
RA 1,754,950 T→A 100% I367F (ATT→TTT)  sufD ← component of SufBCD Fe‑S cluster assembly scaffold
RA 1,755,150 A→T 75.5% L300* (TTG→TAG)  sufD ← component of SufBCD Fe‑S cluster assembly scaffold
RA 1,760,702 G→T 24.8% I747I (ATC→ATA ydiJ ← putative FAD‑linked oxidoreductase
RA 1,764,150 G→T 100% D274Y (GAT→TAT)  ydiK → UPF0118 family inner membrane protein
RA 1,767,220 T→A 26.1% F151Y (TTC→TAC)  ydiN → MFS transporter superfamily protein
RA 1,768,689 C→A 100% S215* (TCA→TAA)  ydiB → quinate/shikimate 5‑dehydrogenase, NAD(P)‑binding
RA 1,769,763 T→A 100% intergenic (+62/‑81) aroD → / → ydiF 3‑dehydroquinate dehydratase/putative acetyl‑CoA:acetoacetyl‑CoA transferase: alpha subunit/beta subunit
RA 1,770,281 T→A 100% D146E (GAT→GAA ydiF → putative acetyl‑CoA:acetoacetyl‑CoA transferase: alpha subunit/beta subunit
RA 1,770,878 C→A 12.5% I345I (ATC→ATA ydiF → putative acetyl‑CoA:acetoacetyl‑CoA transferase: alpha subunit/beta subunit
RA 1,777,451 C→A 100% A55E (GCG→GAG)  fadK → short chain acyl‑CoA synthetase, anaerobic
RA 1,781,790 A→T 23.5% Q30L (CAA→CTA)  ppsR → bifunctional regulatory protein: PEP synthase kinase and PEP synthase pyrophosphorylase
RA 1,782,065 A→T 58.8% N122Y (AAT→TAT)  ppsR → bifunctional regulatory protein: PEP synthase kinase and PEP synthase pyrophosphorylase
RA 1,782,353 C→A 10.4% R218S (CGC→AGC)  ppsR → bifunctional regulatory protein: PEP synthase kinase and PEP synthase pyrophosphorylase
RA 1,783,091 G→T 100% E134* (GAG→TAG)  aroH → 3‑deoxy‑D‑arabino‑heptulosonate‑7‑phosphate synthase, tryptophan repressible
RA 1,784,871 C→A 23.7% D211Y (GAT→TAT)  ydiU ← UPF0061 family protein
RA 1,787,242 C→A 18.0% D192Y (GAT→TAT)  btuD ← vitamin B12 transporter subunit : ATP‑binding component of ABC superfamily
RA 1,788,346 C→A 29.1% T7T (ACG→ACT btuE ← glutathione peroxidase
RA 1,791,290 G→T 5.1% I304I (ATC→ATA pheT ← phenylalanine tRNA synthetase, beta subunit
RA 1,796,101 C→A 100% D243Y (GAC→TAC)  thrS ← threonyl‑tRNA synthetase
RA 1,800,129 C→T 100% W71* (TGG→TAG)  ydiY ← acid‑inducible putative outer membrane protein
RA 1,802,047 G→A 100% intergenic (+100/‑6) ydiZ → / → yniA uncharacterized protein/fructosamine kinase family protein
RA 1,803,109 C→T 100% A128T (GCC→ACC)  yniB ← putative inner membrane protein
RA 1,812,514 C→A 100% D82Y (GAT→TAT)  chbF ← phospho‑chitobiase; general 6‑phospho‑beta‑glucosidase activity
RA 1,818,738 C→A 68.8% D153Y (GAC→TAC)  ves ← cold‑ and stress‑inducible protein
RA 1,819,265 G→T 5.1% intergenic (‑71/+132) ves ← / ← spy cold‑ and stress‑inducible protein/periplasmic ATP‑independent protein refolding chaperone, stress‑induced
RA 1,819,892 C→A 56.1% intergenic (‑10/+320) spy ← / ← astE periplasmic ATP‑independent protein refolding chaperone, stress‑induced/succinylglutamate desuccinylase
RA 1,820,888 C→A 100% C98F (TGC→TTC)  astE ← succinylglutamate desuccinylase
RA 1,821,696 A→T 100% L274Q (CTG→CAG)  astB ← succinylarginine dihydrolase
RA 1,823,802 C→A 24.6% V64F (GTT→TTT)  astD ← succinylglutamic semialdehyde dehydrogenase
RA 1,825,763 C→A 100% A159A (GCG→GCT astC ← succinylornithine transaminase, PLP‑dependent
RA 1,829,319 C→A 100% I85I (ATC→ATA ydjZ → TVP38/TMEM64 family inner membrane protein
RA 1,832,413 C→A 100% L315L (CTC→CTA ynjC → inner membrane putative ABC superfamily transporter permease
RA 1,833,730 C→A 100% R3S (CGT→AGT)  ynjE → molybdopterin synthase sulfurtransferase
RA 1,836,179 G→A 25.4% Q72* (CAG→TAG)  ynjH ← DUF1496 family protein
RA 1,836,192 T→A 100% I67I (ATA→ATT ynjH ← DUF1496 family protein
RA 1,839,854 C→A 66.8% R455L (CGC→CTC)  topB ← DNA topoisomerase III
RA 1,842,276 T→A 29.0% intergenic (‑11/+106) selD ← / ← ydjA selenophosphate synthase/putative oxidoreductase
RA 1,849,178 A→T 12.7% intergenic (‑67/+70) ydjF ← / ← ydjG putative DNA‑binding transcriptional regulator/alpha‑Keto reductase, NADH‑dependent; can use methylglyoxal as substrate
RA 1,850,851 G→A 5.9% T112I (ACA→ATA)  ydjH ← putative kinase
RA 1,852,274 C→A 100% D273Y (GAT→TAT)  ydjJ ← putative Zn‑dependent NAD(P)‑binding oxidoreductase
RA 1,852,913 C→A 71.0% E60* (GAA→TAA)  ydjJ ← putative Zn‑dependent NAD(P)‑binding oxidoreductase
RA 1,855,239 A→T 61.9% N117K (AAT→AAA ydjL ← putative Zn‑dependent NAD(P)‑binding oxidoreductase
RA 1,858,693 T→A 19.9% L196Q (CTG→CAG)  yeaD → D‑hexose‑6‑phosphate epimerase‑like protein
RA 1,859,132 A→C 100% A254A (GCT→GCG yeaE ← aldo‑keto reductase, methylglyoxal to acetol, NADPH‑dependent
RA 1,860,183 G→T 100% R183S (CGC→AGC)  mipA ← scaffolding protein for murein synthesizing machinery
RA 1,860,951 A→C 9.0% intergenic (‑222/‑214) mipA ← / → yeaG scaffolding protein for murein synthesizing machinery/protein kinase, endogenous substrate unidentified; autokinase
RA 1,865,000 C→A 100% P120Q (CCA→CAA)  yeaI → putative membrane‑anchored diguanylate cyclase
RA 1,865,422 C→A 100% R261R (CGA→AGA)  yeaI → putative membrane‑anchored diguanylate cyclase
RA 1,865,836 G→T 31.3% D399Y (GAT→TAT)  yeaI → putative membrane‑anchored diguanylate cyclase
RA 1,870,743 C→A 100% H272N (CAT→AAT)  yeaN → putative transporter
RA 1,872,054 A→T 100% E28V (GAG→GTG)  yeaP → diguanylate cyclase
RA 1,872,520 G→T 100% P183P (CCG→CCT yeaP → diguanylate cyclase
RA 1,872,783 C→A 23.7% S271* (TCG→TAG)  yeaP → diguanylate cyclase
RA 1,874,924 T→A 100% V31V (GTA→GTT leuE ← leucine efflux protein
RA 1,875,096 G→T 100% intergenic (‑80/+47) leuE ← / ← dmlR leucine efflux protein/transcriptional activator of dmlA
RA 1,881,557 C→A 22.6% R231L (CGC→CTC)  rnd ← ribonuclease D
RA 1,881,645 C→A 100% D202Y (GAT→TAT)  rnd ← ribonuclease D
RA 1,885,611 G→T 100% R628S (CGT→AGT)  yoaA ← putative ATP‑dependent helicase, DinG family
RA 1,886,725 G→T 100% I256I (ATC→ATA yoaA ← putative ATP‑dependent helicase, DinG family
RA 1,899,504 T→C 13.1% V149V (GTT→GTC yobD → UPF0266 family inner membrane protein
RA 1,902,080 T→A 8.6% intergenic (‑232/+438) yobF ← / ← yebO DUF2527 family heat‑induced protein/putative inner membrane protein
RA 1,909,342 T→A 100% E150D (GAA→GAT proQ ← RNA chaperone, putative ProP translation regulator
RA 1,916,375 G→T 20.0% intergenic (+102/‑3) yebV → / → yebW uncharacterized protein/uncharacterized protein
RA 1,922,164 C→A 72.2% P311P (CCG→CCT ptrB ← protease II
RA 1,925,398 C→A 9.5% A87A (GCC→GCA purT → phosphoribosylglycinamide formyltransferase 2
RA 1,928,359 A→C 5.8% F168C (TTT→TGT)  edd ← 6‑phosphogluconate dehydratase
RA 1,932,296 G→T 58.1% D131Y (GAT→TAT)  pykA → pyruvate kinase II
RA 1,932,622 C→A 7.1% I239I (ATC→ATA pykA → pyruvate kinase II
RA 1,932,701 C→A 21.5% Q266K (CAG→AAG)  pykA → pyruvate kinase II
RA 1,933,029 A→T 6.7% H375L (CAC→CTC)  pykA → pyruvate kinase II
RA 1,940,498 G→T 100% intergenic (‑61/‑10) yobI ← / → yebB uncharacterized protein/DUF830 family protein
RA 1,940,633 C→A 15.5% I42I (ATC→ATA yebB → DUF830 family protein
RA 1,944,177 C→A 100% L201L (CTG→CTT aspS ← aspartyl‑tRNA synthetase
RA 1,945,085 C→A 7.5% intergenic (‑306/‑4) aspS ← / → yecD aspartyl‑tRNA synthetase/isochorismatase family protein
RA 1,951,334 C→A 100% T352T (ACG→ACT torY ← TMAO reductase III (TorYZ), cytochrome c‑type subunit
RA 1,953,876 C→A 100% P76P (CCG→CCT yecM ← putative metal‑binding enzyme
RA 1,955,401 C→A 59.6% S361S (TCC→TCA argS → arginyl‑tRNA synthetase
RA 1,959,915 C→A 100% P178P (CCG→CCT flhB ← flagellin export apparatus, substrate specificity protein
RA 1,962,923 C→A 100% M233I (ATG→ATT cheR ← chemotaxis regulator, protein‑glutamate methyltransferase
RA 1,963,075 G→T 58.8% R183R (CGG→AGG)  cheR ← chemotaxis regulator, protein‑glutamate methyltransferase
RA 1,963,622 A→T 19.7% intergenic (‑1/+18) cheR ← / ← tap chemotaxis regulator, protein‑glutamate methyltransferase/methyl‑accepting protein IV
RA 1,969,291 G→T 100% I97I (ATC→ATA cheA ← fused chemotactic sensory histidine kinase in two‑component regulatory system with CheB and CheY: sensory histidine kinase/signal sensing protein
RA 1,970,820 G→T 67.8% R193S (CGT→AGT)  motA ← proton conductor component of flagella motor
RA 1,984,987 C→A 100% T38T (ACG→ACT yecA ← UPF0149 family protein
RA 1,986,289 T→A 100% N4Y (AAT→TAT)  pgsA ← phosphatidylglycerophosphate synthetase
RA 1,993,530 C→A 100% E113* (GAG→TAG)  fliY ← cystine transporter subunit
RA 1,997,314 G→T 100% intergenic (‑227/‑39) fliC ← / → fliD flagellar filament structural protein (flagellin)/flagellar filament capping protein
RA 1,999,632 G→T 100% intergenic (+73/‑5) fliT → / → amyA putative flagellar synthesis and assembly chaperone/cytoplasmic alpha‑amylase
RA 2,002,354 C→A 100% L199L (CTC→CTA yedE → UPF0394 family sulfur transport domain‑containing inner membrane protein
RA 2,003,722 G→T 7.5% E141* (GAA→TAA)  yedK → DUF159 family protein
RA 2,004,533 G→T 100% T151T (ACG→ACT yedL → putative acyl transferase
RA 2,008,669 C→A 28.1% T103T (ACC→ACA fliG → flagellar motor switching and energizing component
RA 2,015,913 G→T 7.5% T188T (ACG→ACT fliP → flagellar biosynthesis protein
RA 2,020,166 C→A 100% D445Y (GAC→TAC)  yedQ ← putative membrane‑anchored diguanylate cyclase
RA 2,021,954 C→A 65.9% E298D (GAG→GAT yedI ← DUF808 family inner membrane protein
RA 2,027,334 G→T 7.7% intergenic (+114/‑198) rseX → / → yedS sRNA antisense regulator of ompA and ompC translation, Hfq‑dependent/pseudogene, outer membrane protein homology; putative outer membrane protein
RA 2,035,090 C→A 100% Q79K (CAG→AAG)  zinT → zinc and cadmium binding protein, periplasmic
RA 2,036,102 C→A 12.0% S85* (TCG→TAG)  yodB → cytochrome b561 homolog
RA 2,040,890 C→A 25.9% G824G (GGC→GGA yeeJ → putative adhesin
RA 2,041,346 C→A 100% I976I (ATC→ATA yeeJ → putative adhesin
RA 2,043,643 T→A 16.9% L1742Q (CTG→CAG)  yeeJ → putative adhesin
RA 2,046,600 G→T 100% pseudogene (210/1053 nt) yeeL ← pseudogene, glycosyltransferase homology
RA 2,049,111 C→A 100% T190T (ACC→ACA amn → AMP nucleosidase
RA 2,064,466 C→A 27.0% pseudogene (326/552 nt) yeeP → pseudogene, CP4‑44 prophage; 50S ribosome‑binding GTPase family;Phage or Prophage Related; putative histone
RA 2,067,908 T→A 65.5% V963V (GTT→GTA flu → CP4‑44 prophage; antigen 43 (Ag43) phase‑variable biofilm formation autotransporter
RA 2,069,147 G→T 12.5% P296P (CCG→CCT yeeR → CP4‑44 prophage; putative membrane protein
RA 2,074,680 A→T 100% W22R (TGG→AGG)  sbmC ← DNA gyrase inhibitor
RA 2,076,118 C→T 22.6% intergenic (‑90/‑119) dacD ← / → sbcB D‑alanyl‑D‑alanine carboxypeptidase (penicillin‑binding protein 6b)/exodeoxyribonuclease I; exonuclease I
RA 2,077,212 A→T 100% N326Y (AAT→TAT)  sbcB → exodeoxyribonuclease I; exonuclease I
JC JC 2,080,274 IS2 (–) +5 bp 100% coding (266‑270/1359 nt) plaP ← putrescine importer, low affinity
RA 2,086,004 C→A 100% A42A (GCC→GCA hisC → histidinol‑phosphate aminotransferase
RA 2,093,160 A→C 8.6% intergenic (‑66/+183) ugd ← / ← gnd UDP‑glucose 6‑dehydrogenase/6‑phosphogluconate dehydrogenase, decarboxylating
RA 2,093,612 C→A 67.1% E380* (GAA→TAA)  gnd ← 6‑phosphogluconate dehydrogenase, decarboxylating
RA 2,093,906 C→A 22.7% E282* (GAG→TAG)  gnd ← 6‑phosphogluconate dehydrogenase, decarboxylating
RA 2,098,995 C→A 100% G182* (GGA→TGA)  wbbI ← d‑Galf:alpha‑d‑Glc beta‑1,6‑galactofuranosyltransferase
RA 2,099,341 T→G 28.2% L66F (TTA→TTC wbbI ← d‑Galf:alpha‑d‑Glc beta‑1,6‑galactofuranosyltransferase
RA 2,101,912 T→G 100% E385A (GAG→GCG)  wzxB ← putative polisoprenol‑linked O‑antigen transporter
RA 2,102,391 A→C 28.0% S225S (TCT→TCG wzxB ← putative polisoprenol‑linked O‑antigen transporter
RA 2,107,728 C→A 29.1% E27D (GAG→GAT wcaN ← putative regulatory subunit for GalU
RA 2,108,219:1 +A 100% coding (1159/1395 nt) wcaM ← colanic acid biosynthesis protein
RA 2,109,267 A→T 8.1% I37I (ATT→ATA wcaM ← colanic acid biosynthesis protein
RA 2,109,283 C→G 6.7% R32P (CGA→CCA)  wcaM ← colanic acid biosynthesis protein
RA 2,110,346 G→A 100% T88I (ACC→ATC)  wcaL ← putative glycosyl transferase
RA 2,114,911 A→T 100% L42Q (CTG→CAG)  wcaJ ← colanic biosynthesis UDP‑glucose lipid carrier transferase
RA 2,118,194 A→T 7.6% L345Q (CTG→CAG)  wcaI ← putative glycosyl transferase
RA 2,122,013 G→T 100% T119T (ACC→ACA wcaF ← putative acyl transferase
RA 2,122,266 G→T 100% S35* (TCG→TAG)  wcaF ← putative acyl transferase
RA 2,122,453 C→T 100% A227T (GCT→ACT)  wcaE ← putative glycosyl transferase
RA 2,122,653 C→T 100% W160* (TGG→TAG)  wcaE ← putative glycosyl transferase
RA 2,124,268 A→T 6.2% F31Y (TTC→TAC)  wcaD ← putative colanic acid polymerase
RA 2,126,771 C→A 13.7% E36D (GAG→GAT wcaA ← putative glycosyl transferase
RA 2,128,128 T→A 100% K336* (AAA→TAA)  wzc ← colanic acid production tyrosine‑protein kinase; autokinase; Ugd phosphorylase
RA 2,138,039 C→A 74.1% I431I (ATC→ATA yegE → putative diguanylate cyclase
RA 2,138,702 T→A 25.7% S652R (AGT→AGA yegE → putative diguanylate cyclase
RA 2,139,910 G→T 100% R1055L (CGA→CTA)  yegE → putative diguanylate cyclase
RA 2,141,613 G→T 70.2% V153V (GTG→GTT yegD → Hsp70 chaperone family protein
RA 2,144,474 C→A 100% intergenic (‑8/‑192) yegI ← / → yegJ protein kinase‑related putative non‑specific DNA‑binding protein/uncharacterized protein
RA 2,149,603 A→T 100% E287V (GAA→GTA)  mdtB → multidrug efflux system, subunit B
RA 2,152,444 C→A 100% A193E (GCG→GAG)  mdtC → multidrug efflux system, subunit C
RA 2,167,068 C→A 25.8% V230V (GTG→GTT gatC ← galactitol PTS permease ‑ GatC subunit
RA 2,168,795 C→A 100% D336Y (GAT→TAT)  gatZ ← D‑tagatose 1,6‑bisphosphate aldolase 2, subunit
RA 2,169,260 C→A 9.2% A181S (GCC→TCC)  gatZ ← D‑tagatose 1,6‑bisphosphate aldolase 2, subunit
RA 2,170,534 C→A 29.1% T50T (ACG→ACT gatY ← D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit
RA 2,170,708 G→T 7.5% intergenic (‑25/+283) gatY ← / ← fbaB D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I
RA 2,170,713 C→A 20.1% intergenic (‑30/+278) gatY ← / ← fbaB D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I
RA 2,170,724 G→T 23.4% intergenic (‑41/+267) gatY ← / ← fbaB D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I
RA 2,170,757 T→A 5.0% intergenic (‑74/+234) gatY ← / ← fbaB D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I
RA 2,170,758 C→A 7.2% intergenic (‑75/+233) gatY ← / ← fbaB D‑tagatose 1,6‑bisphosphate aldolase 2, catalytic subunit/fructose‑bisphosphate aldolase class I
RA 2,175,947 A→T 6.1% V105E (GTG→GAG)  yegW ← putative DNA‑binding transcriptional regulator
RA 2,178,914 G→T 9.7% intergenic (‑134/+89) thiM ← / ← rcnR hydoxyethylthiazole kinase/transcriptional repressor of rcnA
RA 2,179,205 G→T 100% A24E (GCG→GAG)  rcnR ← transcriptional repressor of rcnA
RA 2,179,279 A→T 29.9% intergenic (‑4/‑117) rcnR ← / → rcnA transcriptional repressor of rcnA/membrane protein conferring nickel and cobalt resistance
RA 2,181,645 A→G 100% N83N (AAT→AAC yehA ← putative fimbrial‑like adhesin protein
RA 2,183,642 C→A 27.8% D250Y (GAT→TAT)  yehB ← putative outer membrane protein
RA 2,194,695 T→A 100% L313Q (CTA→CAA)  yehI → DUF4132 domain‑containing protein
RA 2,195,449 A→T 100% E564D (GAA→GAT yehI → DUF4132 domain‑containing protein
RA 2,198,343 C→A 100% S90Y (TCT→TAT)  yehL → putative ABC superfamily transporter ATP‑binding subunit
RA 2,201,014 C→A 22.2% A614E (GCG→GAG)  yehM → uncharacterized protein
RA 2,209,162 C→A 100% I9I (ATC→ATA yohO → putative membrane protein
RA 2,211,664 C→A 28.7% D125Y (GAT→TAT)  yehY ← inner membrane putative ABC superfamily transporter permease
RA 2,216,296 C→A 100% I211I (ATC→ATA dld → D‑lactate dehydrogenase, FAD‑binding, NADH independent
RA 2,218,022 C→A 100% E110* (GAA→TAA)  pbpG ← D‑alanyl‑D‑alanine endopeptidase
RA 2,222,684 G→C 6.0% intergenic (+140/+233) yohP → / ← dusC uncharacterized protein/tRNA‑dihydrouridine synthase C
RA 2,222,970 T→A 100% N299Y (AAT→TAT)  dusC ← tRNA‑dihydrouridine synthase C
RA 2,223,247 C→T 100% W206* (TGG→TGA dusC ← tRNA‑dihydrouridine synthase C
RA 2,225,190 C→T 100% G231G (GGC→GGT yohK → LrgB family inner membrane protein
RA 2,226,594 G→T 25.8% G80C (GGT→TGT)  sanA → vancomycin high temperature exclusion protein, DUF218 superfamily protein
RA 2,234,532 C→A 100% D206Y (GAT→TAT)  galS ← galactose‑ and fucose‑inducible galactose regulon transcriptional isorepressor; mgl operon transcriptional repressor; autorepressor
RA 2,237,098 G→T 100% H12N (CAT→AAT)  folE ← GTP cyclohydrolase I
RA 2,240,676 C→A 19.2% D446Y (GAC→TAC)  lysP ← lysine transporter
RA 2,241,222 T→G 100% I264L (ATT→CTT)  lysP ← lysine transporter
RA 2,243,991 T→A 67.3% W266R (TGG→AGG)  yeiH → UPF0324 family inner membrane protein
RA 2,245,476 G→A 59.2% A100T (GCC→ACC)  yeiI → putative kinase
RA 2,247,093 A→T 6.1% C178S (TGT→AGT)  nupX ← nucleoside permease
RA 2,248,657 C→A 100% K3N (AAG→AAT rihB ← ribonucleoside hydrolase 2
RA 2,253,174 T→A 62.8% intergenic (‑399/+24) psuK ← / ← fruA pseudouridine kinase/fused fructose‑specific PTS enzymes: IIBcomponent/IIC components
RA 2,263,137 C→A 100% intergenic (+91/‑321) lpxT → / → mepS lipid A 1‑diphosphate synthase; undecaprenyl pyrophosphate:lipid A 1‑phosphate phosphotransferase/murein DD‑endopeptidase, space‑maker hydrolase, mutational suppressor of prc thermosensitivity, outer membrane lipoprotein
RA 2,264,143 G→A 100% intergenic (+119/‑62) mepS → / → rtn murein DD‑endopeptidase, space‑maker hydrolase, mutational suppressor of prc thermosensitivity, outer membrane lipoprotein/resistance protein for phages lambda and N4, putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA 2,269,345 C→A 8.0% V198V (GTC→GTA yejE → microcin C transporter YejABEF, permease subunit; ABC family
RA 2,270,918 C→A 28.3% N380K (AAC→AAA yejF → microcin C transporter, ATP‑binding subunit; ABC family
RA 2,287,829 C→A 100% S185S (TCG→TCT ccmF ← heme lyase, CcmF subunit
RA 2,289,043 C→A 100% W8L (TGG→TTG)  ccmD ← cytochrome c biogenesis protein
RA 2,289,374 C→A 100% V142V (GTG→GTT ccmC ← heme exporter subunit
RA 2,294,862 G→T 28.2% I457I (ATC→ATA napA ← nitrate reductase, periplasmic, large subunit
RA 2,298,128 C→T 6.1% intergenic (+256/+459) eco → / ← mqo ecotin, a serine protease inhibitor/malate dehydrogenase, FAD/NAD(P)‑binding domain
RA 2,303,070 T→G 100% Q272P (CAG→CCG)  ada ← fused DNA‑binding transcriptional dual regulator/O6‑methylguanine‑DNA methyltransferase
RA 2,305,116 C→A 100% intergenic (‑103/+9) apbE ← / ← ompC putative thiamine‑synthetic flavin transferase lipoprotein/outer membrane porin protein C
RA 2,305,135 T→C 100% Y365C (TAC→TGC)  ompC ← outer membrane porin protein C
RA 2,310,875 A→T 26.7% I827I (ATT→ATA rcsC ← hybrid sensory kinase in two‑component regulatory system with RcsB and YojN
RA 2,311,982 C→A 28.7% E458D (GAG→GAT rcsC ← hybrid sensory kinase in two‑component regulatory system with RcsB and YojN
RA 2,313,625 T→A 6.0% V35E (GTA→GAA)  atoS → sensory histidine kinase in two‑component regulatory system with AtoC
RA 2,318,825 G→T 100% V197V (GTG→GTT atoE → short chain fatty acid transporter
RA 2,319,752 C→A 100% N55K (AAC→AAA atoB → acetyl‑CoA acetyltransferase
RA 2,320,529 T→A 6.2% I314I (ATT→ATA atoB → acetyl‑CoA acetyltransferase
RA 2,322,609 C→A 100% W223L (TGG→TTG)  yfaQ ← tandem DUF2300 domain protein, putative host defense protein
RA 2,330,502 C→A 100% D800Y (GAT→TAT)  gyrA ← DNA gyrase (type II topoisomerase), subunit A
RA 2,334,722 C→A 10.4% R976L (CGA→CTA)  yfaL ← adhesin
RA 2,338,233 A→C 57.0% intergenic (‑585/‑111) yfaL ← / → nrdA adhesin/ribonucleoside‑diphosphate reductase 1, alpha subunit
RA 2,339,641 T→A 21.8% V433E (GTG→GAG)  nrdA → ribonucleoside‑diphosphate reductase 1, alpha subunit
RA 2,341,226 T→A 8.5% S122T (TCC→ACC)  nrdB → ribonucleoside‑diphosphate reductase 1, beta subunit, ferritin‑like protein
RA 2,342,897 C→A 100% D19Y (GAC→TAC)  inaA ← acid‑inducible Kdo/WaaP family putative kinase
RA 2,348,894 T→A 100% V384E (GTG→GAG)  glpB → sn‑glycerol‑3‑phosphate dehydrogenase (anaerobic), membrane anchor subunit
RA 2,352,573 C→A 100% P353P (CCG→CCT rhmT ← putative L‑rhamnonate transporter
RA 2,358,641 G→T 100% I153I (ATC→ATA ais ← putative LPS core heptose(II)‑phosphate phosphatase
RA 2,359,147 T→A 10.7% intergenic (‑48/‑260) ais ← / → arnB putative LPS core heptose(II)‑phosphate phosphatase/uridine 5'‑(beta‑1‑threo‑pentapyranosyl‑4‑ulose diphosphate) aminotransferase, PLP‑dependent
RA 2,359,673 G→T 100% M89I (ATG→ATT arnB → uridine 5'‑(beta‑1‑threo‑pentapyranosyl‑4‑ulose diphosphate) aminotransferase, PLP‑dependent
RA 2,362,338 T→A 100% L274Q (CTG→CAG)  arnA → fused UDP‑L‑Ara4N formyltransferase/UDP‑GlcA C‑4'‑decarboxylase
RA 2,370,361:1 +G 100% coding (711/759 nt) menH ← 2‑succinyl‑6‑hydroxy‑2, 4‑cyclohexadiene‑1‑carboxylate synthase
RA 2,370,765 G→C 58.6% L103V (CTT→GTT)  menH ← 2‑succinyl‑6‑hydroxy‑2, 4‑cyclohexadiene‑1‑carboxylate synthase
RA 2,370,840 G→A 11.5% L78F (CTT→TTT)  menH ← 2‑succinyl‑6‑hydroxy‑2, 4‑cyclohexadiene‑1‑carboxylate synthase
RA 2,370,987 C→A 100% E29* (GAA→TAA)  menH ← 2‑succinyl‑6‑hydroxy‑2, 4‑cyclohexadiene‑1‑carboxylate synthase
RA 2,374,303 T→G 7.3% A68A (GCA→GCC elaB ← DUF883 family protein, putative membrane‑anchored ribosome‑binding protein
RA 2,376,959 C→T 100% N256N (AAC→AAT elaD → protease, capable of cleaving an AMC‑ubiquitin model substrate
RA 2,380,078 C→T 100% S247F (TCT→TTT)  yfbL → putative peptidase
RA 2,383,897 C→A 100% R363L (CGC→CTC)  nuoN ← NADH:ubiquinone oxidoreductase, membrane subunit N
RA 2,399,210 G→T 100% S304* (TCA→TAA)  lrhA ← transcriptional repressor of flagellar, motility and chemotaxis genes
RA 2,400,858 C→A 100% intergenic (‑738/‑182) lrhA ← / → alaA transcriptional repressor of flagellar, motility and chemotaxis genes/valine‑pyruvate aminotransferase 2
RA 2,400,876 C→T 17.0% intergenic (‑756/‑164) lrhA ← / → alaA transcriptional repressor of flagellar, motility and chemotaxis genes/valine‑pyruvate aminotransferase 2
RA 2,404,772 C→A 100% A20A (GCG→GCT yfbS ← putative transporter
RA 2,405,946 T→G 100% Q43P (CAG→CCG)  yfbU ← UPF0304 family protein
RA 2,409,935 G→T 68.2% A570A (GCG→GCT pta → phosphate acetyltransferase
RA 2,410,089 G→T 6.6% D622Y (GAC→TAC)  pta → phosphate acetyltransferase
RA 2,411,263 T→A 11.7% V235E (GTG→GAG)  yfcC → putative inner membrane transporter, C4‑dicarboxylate anaerobic carrier family
RA 2,411,273 C→A 12.5% I238I (ATC→ATA yfcC → putative inner membrane transporter, C4‑dicarboxylate anaerobic carrier family
RA 2,411,701 T→A 27.8% L381* (TTA→TAA)  yfcC → putative inner membrane transporter, C4‑dicarboxylate anaerobic carrier family
RA 2,412,205 C→A 100% D151Y (GAT→TAT)  yfcD ← putative NUDIX hydrolase
RA 2,416,101 C→A 100% intergenic (+21/+27) yfcH → / ← yfcI putative NAD‑dependent nucleotide‑sugar epimerase/transposase_31 family protein
RA 2,419,993 G→T 24.8% S92* (TCG→TAG)  hisJ ← histidine/lysine/arginine/ornithine transporter subunit
RA 2,422,841 C→A 100% D293Y (GAT→TAT)  purF ← amidophosphoribosyltransferase
RA 2,424,074 C→T 100% D57N (GAC→AAC)  cvpA ← colicin V production membrane protein
RA 2,424,448 A→C 32.1% intergenic (‑206/+53) cvpA ← / ← dedD colicin V production membrane protein/membrane‑anchored periplasmic protein involved in septation
RA 2,427,265 C→A 25.3% P47P (CCG→CCT accD ← acetyl‑CoA carboxylase, beta (carboxyltransferase) subunit
RA 2,428,546 C→A 28.2% V190V (GTG→GTT truA ← tRNA pseudouridine(38‑40) synthase
RA 2,450,335 C→T 100% intergenic (‑44/+159) sixA ← / ← fadJ phosphohistidine phosphatase/fused enoyl‑CoA hydratase and epimerase and isomerase/3‑hydroxyacyl‑CoA dehydrogenase
RA 2,450,346 G→T 100% intergenic (‑55/+148) sixA ← / ← fadJ phosphohistidine phosphatase/fused enoyl‑CoA hydratase and epimerase and isomerase/3‑hydroxyacyl‑CoA dehydrogenase
RA 2,450,770 C→A 10.6% V623V (GTG→GTT fadJ ← fused enoyl‑CoA hydratase and epimerase and isomerase/3‑hydroxyacyl‑CoA dehydrogenase
RA 2,452,454 G→T 100% P62Q (CCG→CAG)  fadJ ← fused enoyl‑CoA hydratase and epimerase and isomerase/3‑hydroxyacyl‑CoA dehydrogenase
RA 2,454,297 T→G 100% E39D (GAA→GAC yfcZ ← UPF0381 family protein
RA 2,456,705 C→A 100% S72Y (TCC→TAC)  yfdF → uncharacterized protein
RA 2,459,976 G→T 100% intergenic (+114/‑48) argW → / → intS tRNA‑Arg/CPS‑53 (KpLE1) prophage; putative prophage CPS‑53 integrase
RA 2,463,906 C→A 13.0% Q433K (CAA→AAA)  gtrS → serotype‑specific glucosyl transferase, CPS‑53 (KpLE1) prophage
RA 2,463,910 G→T 10.0% R434I (AGA→ATA)  gtrS → serotype‑specific glucosyl transferase, CPS‑53 (KpLE1) prophage
RA 2,463,915 C→A 11.5% Q436K (CAA→AAA)  gtrS → serotype‑specific glucosyl transferase, CPS‑53 (KpLE1) prophage
RA 2,467,970 G→T 59.7% D154Y (GAC→TAC)  yfdQ → CPS‑53 (KpLE1) prophage; uncharacterized protein
RA 2,474,255 T→A 18.6% E467D (GAA→GAT emrY ← putative multidrug efflux system
RA 2,474,353 G→T 100% Q435K (CAG→AAG)  emrY ← putative multidrug efflux system
RA 2,474,418 G→T 100% S413* (TCA→TAA)  emrY ← putative multidrug efflux system
RA 2,475,279 A→T 14.7% L126Q (CTG→CAG)  emrY ← putative multidrug efflux system
RA 2,476,524 T→A 100% N99Y (AAT→TAT)  emrK ← EmrKY‑TolC multidrug resistance efflux pump, membrane fusion protein component
RA 2,478,201 G→T 26.8% E117* (GAA→TAA)  evgS → hybrid sensory histidine kinase in two‑component regulatory system with EvgA
RA 2,480,932 A→C 6.3% Q1027P (CAA→CCA)  evgS → hybrid sensory histidine kinase in two‑component regulatory system with EvgA
RA 2,481,488 A→T 29.5% intergenic (+42/+14) evgS → / ← yfdE hybrid sensory histidine kinase in two‑component regulatory system with EvgA/acetyl‑CoA:oxalate CoA‑transferase
RA 2,481,974 G→T 100% S225* (TCA→TAA)  yfdE ← acetyl‑CoA:oxalate CoA‑transferase
RA 2,488,416 G→T 100% P80P (CCG→CCT ypdI → putative lipoprotein involved in colanic acid biosynthesis
RA 2,488,443 T→A 11.3% P89P (CCT→CCA ypdI → putative lipoprotein involved in colanic acid biosynthesis
RA 2,497,475 C→A 5.0% E164* (GAG→TAG)  fryA ← putative PTS enzyme, Hpr component/enzyme I component/enzyme IIA component
RA 2,497,946 G→T 100% L7I (CTC→ATC)  fryA ← putative PTS enzyme, Hpr component/enzyme I component/enzyme IIA component
RA 2,499,180 G→T 22.6% T311K (ACG→AAG)  ypdF ← Xaa‑Pro aminopeptidase
RA 2,499,568 C→A 100% D182Y (GAC→TAC)  ypdF ← Xaa‑Pro aminopeptidase
RA 2,512,031 C→A 13.1% S29* (TCA→TAA)  yfeC → DUF1323 family putative DNA‑binding protein
RA 2,512,279 G→T 59.3% D112Y (GAT→TAT)  yfeC → DUF1323 family putative DNA‑binding protein
RA 2,513,935 A→T 68.6% Y73N (TAC→AAC)  gltX ← glutamyl‑tRNA synthetase
RA 2,520,652 C→A 100% I116I (ATC→ATA yfeH → putative inorganic ion transporter
RA 2,521,009 C→A 8.4% V235V (GTC→GTA yfeH → putative inorganic ion transporter
RA 2,524,056 C→A 100% A179A (GCG→GCT zipA ← FtsZ stabilizer
RA 2,526,794 C→T 100% intergenic (+55/‑329) cysK → / → ptsH cysteine synthase A, O‑acetylserine sulfhydrolase A subunit/phosphohistidinoprotein‑hexose phosphotransferase component of PTS system (Hpr)
RA 2,526,934 C→A 10.2% intergenic (+195/‑189) cysK → / → ptsH cysteine synthase A, O‑acetylserine sulfhydrolase A subunit/phosphohistidinoprotein‑hexose phosphotransferase component of PTS system (Hpr)
RA 2,532,553 C→A 5.3% A130A (GCG→GCT cysM ← cysteine synthase B (O‑acetylserine sulfhydrolase B)
RA 2,542,627 T→G 100% I389M (ATT→ATG yfeW → penicillin binding protein PBP4B; weak DD‑carboxypeptidase activity
RA 2,546,198 T→G 28.8% L163R (CTG→CGG)  amiA → N‑acetylmuramoyl‑l‑alanine amidase I
RA 2,547,821 A→C 7.3% L241V (TTG→GTG)  eutR ← eut operon transcriptional activator, AraC family
RA 2,549,144 C→A 27.2% D206Y (GAT→TAT)  eutL ← putative ethanol utilization carboxysome structural protein
RA 2,549,676 C→A 100% L28L (CTG→CTT eutL ← putative ethanol utilization carboxysome structural protein
RA 2,552,461 A→G 58.1% N82S (AAT→AGT)  intZ → CPZ‑55 prophage; putative phage integrase
RA 2,555,735 G→T 8.3% R89L (CGA→CTA)  yffO → CPZ‑55 prophage; uncharacterized protein
RA 2,556,744 T→C 7.9% intergenic (+268/‑207) yffP → / → yffQ CPZ‑55 prophage; uncharacterized protein/CPZ‑55 prophage; uncharacterized protein
RA 2,556,786 G→T 100% intergenic (+310/‑165) yffP → / → yffQ CPZ‑55 prophage; uncharacterized protein/CPZ‑55 prophage; uncharacterized protein
RA 2,564,340 G→T 9.2% I257I (ATC→ATA eutE ← aldehyde oxidoreductase, ethanolamine utilization protein
RA 2,567,211 C→A 100% D152Y (GAT→TAT)  eutT ← cobalamin adenosyltransferase involved in ethanolamine utilization
RA 2,567,775 G→T 32.5% I196I (ATC→ATA eutQ ← RmlC‑like cupin domain protein
RA 2,568,720 C→T 100% A33T (GCC→ACC)  eutP ← putative P‑loop NTPase ethanolamine utilization protein
RA 2,574,820 C→A 100% A609E (GCG→GAG)  tktB → transketolase 2, thiamine triphosphate‑binding
RA 2,576,325 C→A 100% E171D (GAG→GAT nudK ← GDP‑mannose pyrophosphatase
RA 2,579,561 G→T 100% G158C (GGC→TGC)  narQ → sensory histidine kinase in two‑component regulatory system with NarP (NarL)
RA 2,587,029:1 +G 100% coding (101/699 nt) ypfH ← palmitoyl‑CoA esterase activity, uncertain physiological substrate
RA 2,589,933 G→A 100% T55I (ACC→ATC)  ypfJ ← putative neutral zinc metallopeptidase
RA 2,597,173 T→G 100% L666R (CTG→CGG)  hyfB → hydrogenase 4, membrane subunit
RA 2,601,496 T→A 28.3% F407L (TTT→TTA hyfF → hydrogenase 4, membrane subunit
RA 2,601,971 C→A 9.3% I42I (ATC→ATA hyfG → hydrogenase 4, subunit
RA 2,604,776 A→T 6.9% S238C (AGT→TGT)  hyfI → hydrogenase 4, Fe‑S subunit
RA 2,605,760 C→A 5.3% L168I (CTT→ATT)  hyfR → hydrogenase‑4 transcriptional activator
RA 2,606,516 G→T 100% D420Y (GAC→TAC)  hyfR → hydrogenase‑4 transcriptional activator
RA 2,610,919 C→A 100% intergenic (+3/‑18) bepA → / → yfgD periplasmic metalloprotease and chaperone for OM protein maintenance and assembly/putative oxidoreductase
RA 2,614,168 C→A 100% D22Y (GAT→TAT)  upp ← uracil phosphoribosyltransferase
RA 2,618,693 G→T 100% E74* (GAA→TAA)  ppx → exopolyphosphatase
RA 2,626,389 G→T 23.0% I347I (ATC→ATA guaB ← IMP dehydrogenase
RA 2,632,012 C→A 100% intergenic (‑1/+10) bamB ← / ← yfgM BamABCDE complex OM biogenesis lipoprotein/putative anti‑RcsB factor
RA 2,633,402 C→A 100% R178L (CGC→CTC)  hisS ← histidyl tRNA synthetase
RA 2,634,417 T→G 23.1% K249N (AAA→AAC ispG ← 1‑hydroxy‑2‑methyl‑2‑(E)‑butenyl 4‑diphosphate synthase
RA 2,639,116 C→A 100% A523A (GCG→GCT pbpC ← penicillin‑insensitive murein repair transglycosylase; inactive transpeptidase domain
RA 2,643,336 C→A 100% D771Y (GAC→TAC)  yfhM ← bacterial alpha2‑macroglobulin colonization factor ECAM; anti‑host protease defense factor; periplasmic inner membrane‑anchored lipoprotein
RA 2,645,592 C→A 100% D19Y (GAC→TAC)  yfhM ← bacterial alpha2‑macroglobulin colonization factor ECAM; anti‑host protease defense factor; periplasmic inner membrane‑anchored lipoprotein
RA 2,651,665 G→T 100% G210G (GGC→GGA hscA ← DnaK‑like molecular chaperone specific for IscU
RA 2,655,084 A→C 31.3% L136R (CTG→CGG)  iscR ← isc operon transcriptional repressor; suf operon transcriptional activator; oxidative stress‑ and iron starvation‑inducible; autorepressor
RA 2,659,594 C→A 100% L267L (CTC→CTA csiE → stationary phase inducible protein
RA 2,664,138 A→C 28.0% E130D (GAA→GAC hcaF → 3‑phenylpropionate dioxygenase, small (beta) subunit
RA 2,665,772 G→T 100% E123* (GAA→TAA)  hcaD → phenylpropionate dioxygenase, ferredoxin reductase subunit
RA 2,668,397 C→A 69.5% G242C (GGT→TGT)  yphC ← putative Zn‑dependent NAD(P)‑binding oxidoreductase
RA 2,669,978 C→A 100% A69A (GCG→GCT yphD ← inner membrane putative ABC superfamily sugar transporter permease
RA 2,671,274 C→A 100% T149T (ACG→ACT yphE ← putative sugar transporter subunit of ABC superfamily, ATP‑binding component
RA 2,679,371 G→T 6.5% A60S (GCT→TCT)  hmp → fused nitric oxide dioxygenase/dihydropteridine reductase 2
RA 2,681,873 T→A 100% Q97L (CAG→CTG)  glrR ← response regulator regulating glmY sRNA in two‑component system with sensor protein GlrK
RA 2,683,829 C→A 100% R210L (CGT→CTT)  glrK ← sensor protein kinase regulating glmY sRNA in two‑component system with response regulator GlrR
RA 2,688,006 C→A 100% P299P (CCG→CCT purL ← phosphoribosylformyl‑glycineamide synthetase
RA 2,689,267 C→A 100% I36I (ATC→ATA mltF → membrane‑bound lytic transglycosylase F, murein hydrolase
RA 2,691,904 T→A 27.8% A2A (GCA→GCT pgpC ← phosphatidylglycerophosphatase C, membrane bound
RA 2,692,793 C→A 100% H226N (CAT→AAT)  yfhH → putative DNA‑binding transcriptional regulator
RA 2,694,843 G→T 100% I82I (ATC→ATA pdxJ ← pyridoxine 5'‑phosphate synthase
RA 2,699,380 C→A 100% P368P (CCG→CCT lepA ← back‑translocating elongation factor EF4, GTPase
RA 2,699,880 T→A 100% N202Y (AAC→TAC)  lepA ← back‑translocating elongation factor EF4, GTPase
JC JC 2,709,656 IS2 (–) +5 bp 100% coding (149‑153/384 nt) grcA ← autonomous glycyl radical cofactor
RA 2,711,755 C→A 100% D45Y (GAC→TAC)  yfiF ← putative methyltransferase
RA 2,712,342 T→A 11.5% G83G (GGT→GGA trxC → thioredoxin 2
RA 2,715,643 G→T 100% E778* (GAA→TAA)  pka → protein lysine acetyltransferase
RA 2,719,426 T→C 100% intergenic (‑321/+2) kgtP ← / ← rrfG alpha‑ketoglutarate transporter/5S ribosomal RNA of rrnG operon
RA 2,725,747 G→T 100% R596S (CGC→AGC)  clpB ← protein disaggregation chaperone
RA 2,726,786 C→A 100% A249A (GCG→GCT clpB ← protein disaggregation chaperone
RA 2,727,416 C→A 100% L39L (CTG→CTT clpB ← protein disaggregation chaperone
RA 2,730,042 T→G 58.8% S180A (TCC→GCC)  bamD → BamABCDE complex OM biogenesis lipoprotein
RA 2,733,753 C→T 100% E253K (GAG→AAG)  aroF ← 3‑deoxy‑D‑arabino‑heptulosonate‑7‑phosphate synthase, tyrosine‑repressible
RA 2,736,714 C→A 100% R325S (CGC→AGC)  yfiN → putative membrane‑anchored diguanylate cyclase with an N‑terminal periplasmic domain
RA 2,742,155 C→A 5.9% T8K (ACG→AAG)  yfjD → UPF0053 family inner membrane protein
RA 2,743,438 C→A 100% intergenic (+19/+36) yfjD → / ← grpE UPF0053 family inner membrane protein/heat shock protein
RA 2,751,558 G→T 100% T134T (ACC→ACA yfjH ← CP4‑57 prophage; uncharacterized protein
JC 2,758,771 Δ8 bp 8.2% intergenic (‑259/+94) yfjL ← / ← yfjM CP4‑57 putative defective prophage, DUF4297/DUF1837 polymorphic toxin family protein/CP4‑57 prophage; uncharacterized protein
RA 2,763,057 C→A 100% intergenic (+212/‑5) yfjQ → / → yfjR CP4‑57 prophage; uncharacterized protein/CP4‑57 prophage; putative DNA‑binding transcriptional regulator
RA 2,765,064 T→A 7.8% intergenic (+90/+297) yfjT → / ← yfjU CP4‑57 prophage; putative periplasmic protein/CP4‑57 prophage; conserved protein;Phage or Prophage Related
RA 2,771,358 G→A 100% intergenic (+217/+147) ypjF → / ← ypjA CP4‑57 prophage; toxin of the YpjF‑YfjZ toxin‑antitoxin system/adhesin‑like autotransporter
RA 2,778,820 G→A 100% intergenic (‑450/+301) ypjC ← / ← ileY pseudogene/tRNA‑Ile
RA 2,779,067 C→A 100% intergenic (‑697/+54) ypjC ← / ← ileY pseudogene/tRNA‑Ile
RA 2,792,318 C→A 10.2% intergenic (‑464/‑205) stpA ← / → alaE DNA binding protein, nucleoid‑associated/alanine exporter, alanine‑inducible, stress‑responsive
RA 2,798,195 A→T 100% K8* (AAA→TAA)  proV → glycine betaine transporter subunit
RA 2,801,418 T→G 10.6% W310G (TGG→GGG)  proX → glycine betaine transporter subunit
RA 2,801,706 C→A 100% pseudogene (32/1178 nt) ygaY → pseudogene, major facilitator transporter superfamily;putative transport; Not classified; putative transport protein
RA 2,808,907 C→A 100% E298* (GAA→TAA)  gshA ← glutamate‑cysteine ligase
JC 2,811,717 Δ134 bp 8.0% [argV] [argV]
RA 2,825,783 C→T 100% intergenic (‑135/‑52) norR ← / → norV anaerobic nitric oxide reductase DNA‑binding transcriptional activator/anaerobic nitric oxide reductase flavorubredoxin
RA 2,828,952 C→A 100% T611T (ACG→ACT hypF ← carbamoyl phosphate phosphatase and maturation protein for [NiFe] hydrogenases
RA 2,831,086 C→A 100% E127* (GAA→TAA)  hydN ← formate dehydrogenase‑H, [4Fe‑4S] ferredoxin subunit
RA 2,831,929 T→A 100% E232V (GAA→GTA)  ascG ← asc operon transcriptional repressor; prpBC operon repressor
RA 2,832,734 A→G 35.8% intergenic (‑111/‑149) ascG ← / → ascF asc operon transcriptional repressor; prpBC operon repressor/fused cellobiose/arbutin/salicin‑specific PTS enzymes: IIB component/IC component
RA 2,834,052 C→A 27.5% I390I (ATC→ATA ascF → fused cellobiose/arbutin/salicin‑specific PTS enzymes: IIB component/IC component
RA 2,834,252 A→T 7.1% E457V (GAG→GTG)  ascF → fused cellobiose/arbutin/salicin‑specific PTS enzymes: IIB component/IC component
RA 2,835,094 C→A 100% P249Q (CCG→CAG)  ascB → cryptic 6‑phospho‑beta‑glucosidase
RA 2,836,554 G→T 100% I84I (ATC→ATA hycH ← hydrogenase 3 maturation protein
RA 2,837,721 C→A 100% D131Y (GAC→TAC)  hycF ← formate hydrogenlyase complex iron‑sulfur protein
RA 2,841,044 C→A 100% A519A (GCG→GCT hycC ← hydrogenase 3, membrane subunit
RA 2,844,024 T→A 59.7% C7S (TGC→AGC)  hypA → protein involved in nickel insertion into hydrogenases 3
RA 2,846,112 C→A 100% I206I (ATC→ATA hypD → hydrogenase maturation protein
RA 2,848,002 T→A 100% C102* (TGT→TGA fhlA → formate hydrogenlyase transcriptional activator
RA 2,850,790 C→A 100% I113I (ATC→ATA mutS → methyl‑directed mismatch repair protein
RA 2,852,854 G→T 100% P801P (CCG→CCT mutS → methyl‑directed mismatch repair protein
RA 2,855,673 C→A 14.0% I295I (ATC→ATA ygbJ → putative dehydrogenase
RA 2,863,542 A→T 18.6% V31E (GTG→GAG)  umpG ← broad specificity 5'(3')‑nucleotidase and polyphosphatase
RA 2,869,780 G→A 100% intergenic (‑92/‑160) cysD ← / → iap sulfate adenylyltransferase, subunit 2/aminopeptidase in alkaline phosphatase isozyme conversion
RA 2,870,278 C→A 100% I113I (ATC→ATA iap → aminopeptidase in alkaline phosphatase isozyme conversion
RA 2,871,577 C→A 16.8% intergenic (+600/+351) iap → / ← ygbF aminopeptidase in alkaline phosphatase isozyme conversion/CRISPR adaptation ssRNA endonuclease
RA 2,873,087 G→T 100% V15V (GTC→GTA ygbT ← multifunctional endonuclease Cas1, CRISPR adaptation protein; DNA repair enzyme
RA 2,876,760 C→T 100% G246G (GGG→GGA casA ← CRISP RNA (crRNA) containing Cascade antiviral complex protein
RA 2,878,098 T→A 57.1% A827A (GCA→GCT ygcB ← R‑loop helicase‑annealase Cas3 needed for Cascade anti‑viral activity
RA 2,878,668 G→T 100% V637V (GTC→GTA ygcB ← R‑loop helicase‑annealase Cas3 needed for Cascade anti‑viral activity
RA 2,879,449 G→T 100% S377* (TCA→TAA)  ygcB ← R‑loop helicase‑annealase Cas3 needed for Cascade anti‑viral activity
RA 2,880,751 C→A 100% noncoding (39/56 nt) sokX → sok‑related sRNA, function unknown
RA 2,881,078 G→T 71.0% G198G (GGC→GGA cysH ← phosphoadenosine phosphosulfate reductase; PAPS reductase, thioredoxin dependent
RA 2,881,660 G→T 14.5% L4L (CTC→CTA cysH ← phosphoadenosine phosphosulfate reductase; PAPS reductase, thioredoxin dependent
RA 2,884,385 G→T 100% V291V (GTC→GTA cysJ ← sulfite reductase, alpha subunit, flavoprotein
RA 2,888,584 G→T 100% I185I (ATC→ATA ygcQ ← putative flavoprotein
RA 2,889,129 C→A 100% A4S (GCA→TCA)  ygcQ ← putative flavoprotein
RA 2,893,402 T→A 6.6% A77A (GCA→GCT ygcW ← putative dehydrogenase
RA 2,893,446 T→A 100% K63* (AAA→TAA)  ygcW ← putative dehydrogenase
RA 2,894,388 C→A 61.0% V146V (GTC→GTA yqcE → MFS transporter family protein
RA 2,902,302 C→A 73.5% D242Y (GAT→TAT)  pyrG ← CTP synthetase
RA 2,909,577 T→G 6.0% L388V (TTA→GTA)  barA → hybrid sensory histidine kinase, in two‑component regulatory system with UvrY
RA 2,913,019 C→A 100% A363S (GCT→TCT)  gudX ← glucarate dehydratase‑related protein, substrate unknown
RA 2,913,502 C→A 58.7% D202Y (GAT→TAT)  gudX ← glucarate dehydratase‑related protein, substrate unknown
RA 2,914,467 T→G 58.5% V331V (GTA→GTC gudP ← putative D‑glucarate transporter
RA 2,915,998 C→A 100% A116S (GCT→TCT)  yqcA ← short‑chain flavodoxin, FMN‑binding
RA 2,918,415 G→A 100% P75P (CCC→CCT syd ← SecY‑interacting protein
RA 2,919,922 G→T 100% D86Y (GAT→TAT)  ygdH → UPF0717 family protein
RA 2,920,050 C→A 100% I128I (ATC→ATA ygdH → UPF0717 family protein
RA 2,921,101 C→A 100% intergenic (+70/‑487) ygdH → / → sdaC UPF0717 family protein/putative serine transporter
RA 2,921,245 G→T 100% intergenic (+214/‑343) ygdH → / → sdaC UPF0717 family protein/putative serine transporter
RA 2,931,717 C→A 100% N307K (AAC→AAA fucK → L‑fuculokinase
RA 2,932,236 G→T 12.4% E480D (GAG→GAT fucK → L‑fuculokinase
RA 2,932,835 C→T 100% R37C (CGC→TGC)  fucR → l‑fucose operon activator
RA 2,934,843 G→T 100% H50N (CAT→AAT)  ygdD ← UPF0382 family inner membrane protein
RA 2,936,836 C→A 100% A47A (GCC→GCA csdA → cysteine sulfinate desulfinase
RA 2,939,313 G→T 60.4% intergenic (‑112/+127) tcdA ← / ← mltA tRNA threonylcarbamoyladenosine dehydratase; sulfur acceptor for CsdA/membrane‑bound lytic murein transglycosylase A
RA 2,939,832 C→A 28.0% E236* (GAA→TAA)  mltA ← membrane‑bound lytic murein transglycosylase A
RA 2,939,859 Δ1 bp 6.4% coding (679/1098 nt) mltA ← membrane‑bound lytic murein transglycosylase A
RA 2,939,961 T→G 38.0% S193R (AGT→CGT)  mltA ← membrane‑bound lytic murein transglycosylase A
RA 2,941,341 G→A 100% L343L (CTC→CTT amiC ← N‑acetylmuramoyl‑L‑alanine amidase
RA 2,945,306 C→G 100% G172A (GGC→GCC)  recD ← exonuclease V (RecBCD complex), alpha chain
RA 2,950,431 T→A 30.1% N605Y (AAT→TAT)  ptrA ← protease III
RA 2,959,004 G→A 100% I131I (ATC→ATT lgt ← phosphatidylglycerol‑prolipoprotein diacylglyceryl transferase
RA 2,962,962 T→A 100% intergenic (‑626/‑59) rppH ← / → mutH RNA pyrophosphohydrolase/methyl‑directed mismatch repair protein
RA 2,973,968 T→A 54.0% G9G (GGA→GGT ygeA ← Asp/Glu_racemase family protein
RA 2,974,073 C→T 100% intergenic (‑79/+50) ygeA ← / ← araE Asp/Glu_racemase family protein/arabinose transporter
RA 2,980,488 C→A 100% intergenic (+53/‑407) yqeG → / → yqeH putative transporter/putative LuxR family transcriptional regulator
RA 2,983,568 C→A 22.5% R51I (AGA→ATA)  yqeK ← uncharacterized protein
RA 2,984,747 G→T 100% D41Y (GAT→TAT)  ygeG → SycD‑like chaperone family TPR‑repeat‑containing protein
RA 2,985,256 G→T 100% intergenic (+138/‑197) ygeG → / → ygeH SycD‑like chaperone family TPR‑repeat‑containing protein/putative transcriptional regulator
RA 2,985,472 T→A 26.5% F7Y (TTC→TAC)  ygeH → putative transcriptional regulator
RA 2,985,884 C→T 100% I144I (ATC→ATT ygeH → putative transcriptional regulator
RA 2,986,052 G→T 100% L200F (TTG→TTT ygeH → putative transcriptional regulator
RA 2,988,355 C→A 100% pseudogene (97/633 nt) ygeK ← pseudogene; putative 2‑component transcriptional regulator
RA 2,988,554 G→A 100% intergenic (‑103/+119) ygeK ← / ← ygeN pseudogene; putative 2‑component transcriptional regulator/pseudogene
RA 2,988,934 G→T 28.2% pseudogene (186/447 nt) ygeN ← pseudogene
RA 2,989,295 C→A 100% pseudogene (85/261 nt) ygeN ← pseudogene
RA 2,993,211 C→A 100% V14L (GTG→TTG)  ygeR ← LysM domain‑containing M23 family putative peptidase; septation lipoprotein
RA 2,993,699 C→A 100% intergenic (‑449/‑5) ygeR ← / → xdhA LysM domain‑containing M23 family putative peptidase; septation lipoprotein/xanthine dehydrogenase, molybdenum binding subunit
RA 2,999,827 C→A 100% D69E (GAC→GAA ygeW → putative carbamoyltransferase
RA 3,000,265 G→T 6.0% M215I (ATG→ATT ygeW → putative carbamoyltransferase
RA 3,009,187 G→T 100% intergenic (+90/‑232) mocA → / → ygfK CTP:molybdopterin cytidylyltransferase/putative Fe‑S subunit oxidoreductase subunit
RA 3,010,667 G→T 30.4% D417Y (GAC→TAC)  ygfK → putative Fe‑S subunit oxidoreductase subunit
RA 3,017,285 G→T 100% D871Y (GAC→TAC)  xdhD → putative hypoxanthine oxidase, molybdopterin‑binding/Fe‑S binding
RA 3,018,544 G→T 100% A279S (GCC→TCC)  xanQ → xanthine permease
RA 3,022,562 C→T 100% G577R (GGA→AGA)  ygfT ← putative oxidoreductase, Fe‑S subunit/nucleotide‑binding subunit
RA 3,024,081 A→C 100% V70V (GTT→GTG ygfT ← putative oxidoreductase, Fe‑S subunit/nucleotide‑binding subunit
RA 3,024,983 C→G 100% G86G (GGC→GGG uacT → uric acid permease
RA 3,030,181 G→T 100% H429N (CAT→AAT)  recJ ← ssDNA exonuclease, 5' ‑‑> 3'‑specific
RA 3,030,592 T→A 65.6% N292Y (AAT→TAT)  recJ ← ssDNA exonuclease, 5' ‑‑> 3'‑specific
RA 3,039,409 T→G 10.1% intergenic (‑149/+118) ygfF ← / ← gcvP putative NAD(P)‑dependent oxidoreductase with NAD(P)‑binding Rossmann‑fold domain/glycine decarboxylase, PLP‑dependent, subunit (protein P) of glycine cleavage complex
RA 3,039,703 C→A 100% A900S (GCG→TCG)  gcvP ← glycine decarboxylase, PLP‑dependent, subunit (protein P) of glycine cleavage complex
RA 3,040,479 T→G 13.1% Q641P (CAG→CCG)  gcvP ← glycine decarboxylase, PLP‑dependent, subunit (protein P) of glycine cleavage complex
RA 3,041,321 G→T 100% I360I (ATC→ATA gcvP ← glycine decarboxylase, PLP‑dependent, subunit (protein P) of glycine cleavage complex
RA 3,044,464 G→A 100% intergenic (‑438/+10) gcvT ← / ← ubiI aminomethyltransferase, tetrahydrofolate‑dependent, subunit (T protein) of glycine cleavage complex/2‑octaprenylphenol hydroxylase, FAD‑dependent
RA 3,044,599 T→A 5.7% T360S (ACC→TCC)  ubiI ← 2‑octaprenylphenol hydroxylase, FAD‑dependent
RA 3,049,220 C→A 100% R84R (CGG→AGG)  zapA → FtsZ stabilizer
RA 3,049,730 A→T 6.3% D44V (GAT→GTT)  fau → 5‑formyltetrahydrofolate cyclo‑ligase family protein
RA 3,049,740 C→A 100% L47L (CTC→CTA fau → 5‑formyltetrahydrofolate cyclo‑ligase family protein
RA 3,050,404 G→T 62.1% intergenic (+57/+133) sibC → / ← serA sRNA antisense regulator of toxic IbsC protein/D‑3‑phosphoglycerate dehydrogenase
RA 3,058,769 C→T 100% I203I (ATC→ATT scpC → propionyl‑CoA:succinate CoA transferase
RA 3,062,143 G→A 7.2% L9F (CTT→TTT)  argO ← arginine transporter
RA 3,064,914 G→T 100% I356I (ATC→ATA pgk ← phosphoglycerate kinase
RA 3,065,123 C→T 100% G287S (GGT→AGT)  pgk ← phosphoglycerate kinase
RA 3,066,554 A→T 9.3% L166* (TTG→TAG)  epd ← D‑erythrose 4‑phosphate dehydrogenase
RA 3,068,690 C→A 23.1% V284V (GTG→GTT yggF ← fructose 1,6 bisphosphatase isozyme
RA 3,074,591 G→T 100% A135E (GCG→GAG)  tktA ← transketolase 1, thiamine triphosphate‑binding
RA 3,074,995 T→A 26.8% intergenic (‑1/‑277) tktA ← / → loiP transketolase 1, thiamine triphosphate‑binding/Phe‑Phe periplasmic metalloprotease, OM lipoprotein; low salt‑inducible; heat shock protein that binds Era
RA 3,075,114 C→A 100% intergenic (‑120/‑158) tktA ← / → loiP transketolase 1, thiamine triphosphate‑binding/Phe‑Phe periplasmic metalloprotease, OM lipoprotein; low salt‑inducible; heat shock protein that binds Era
RA 3,076,526 C→A 100% D211Y (GAC→TAC)  speB ← agmatinase
RA 3,077,302 C→A 100% D657Y (GAT→TAT)  speA ← biosynthetic arginine decarboxylase, PLP‑binding
RA 3,080,618 T→A 100% V185E (GTG→GAG)  metK → S‑adenosylmethionine synthetase
RA 3,081,604 C→T 5.1% intergenic (+385/‑39) metK → / → galP S‑adenosylmethionine synthetase/D‑galactose transporter
RA 3,084,305 G→T 61.9% K200N (AAG→AAT endA → DNA‑specific endonuclease I
RA 3,084,798 C→A 100% L102L (CTC→CTA rsmE → 16S rRNA m(3)U1498 methyltransferase, SAM‑dependent
RA 3,086,574 T→A 59.3% F93L (TTT→TTA yqgE → uncharacterized protein
RA 3,088,065 C→A 100% V125V (GTG→GTT yggR ← putative PilT family AAA+ ATPase
RA 3,097,262 C→T 100% F297F (TTC→TTT mutY → adenine DNA glycosylase
RA 3,098,052 C→A 8.8% I87I (ATC→ATA mltC → membrane‑bound lytic murein transglycosylase C
RA 3,098,230 T→A 5.2% W147R (TGG→AGG)  mltC → membrane‑bound lytic murein transglycosylase C
RA 3,106,685 G→T 100% S51Y (TCT→TAT)  yghG ← secretin (GspDbeta) OM localization lipoprotein pilotin
RA 3,107,261 C→A 11.9% D151Y (GAT→TAT)  pppA ← bifunctional prepilin leader peptidase/ methylase
RA 3,110,213 T→A 100% A753A (GCA→GCT yghJ ← DUF4092 family putative lipoprotein peptidase
RA 3,110,751 C→A 100% R574L (CGT→CTT)  yghJ ← DUF4092 family putative lipoprotein peptidase
RA 3,111,434 C→A 100% A346A (GCG→GCT yghJ ← DUF4092 family putative lipoprotein peptidase
RA 3,116,446 A→C 30.3% L240R (CTG→CGG)  glcB ← malate synthase G
RA 3,120,216 C→A 100% D389Y (GAT→TAT)  glcD ← glycolate oxidase subunit, FAD‑linked
RA 3,122,356 G→T 100% L242F (TTG→TTT glcC → glycolate‑inducible glc operon transcriptional repressor; autorepressor
RA 3,122,778 A→C 100% pseudogene (725/1101 nt) yghO ← pseudogene, DNA‑binding transcriptional regulator homology
RA 3,134,528 C→A 100% D40Y (GAT→TAT)  hybD ← maturation protease for hydrogenase 2
RA 3,138,648 T→A 25.0% N325Y (AAC→TAC)  hybO ← hydrogenase 2, small subunit
RA 3,138,777 C→A 32.3% G282C (GGT→TGT)  hybO ← hydrogenase 2, small subunit
RA 3,142,668 G→T 100% L55I (CTC→ATC)  yqhA ← UPF0114 family putative inner membrane protein
RA 3,143,969 G→T 27.4% intergenic (+64/+208) yghA → / ← exbD putative oxidoreductase/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA 3,144,158 C→A 100% intergenic (+253/+19) yghA → / ← exbD putative oxidoreductase/membrane spanning protein in TonB‑ExbB‑ExbD complex
RA 3,151,733 A→T 13.5% D242V (GAT→GTT)  yqhG → DUF3828 family putative periplasmic protein
RA 3,164,230 C→A 100% R130S (CGT→AGT)  qseC → quorum sensing sensory histidine kinase in two‑component regulatory system with QseB
RA 3,169,196 T→A 25.1% E57V (GAA→GTA)  yqiA ← acyl CoA esterase
RA 3,172,251 C→A 25.7% R260S (CGC→AGC)  tolC → transport channel
RA 3,173,669 G→T 100% A189A (GCG→GCT ygiB → DUF1190 family protein
RA 3,176,733 G→T 100% intergenic (+51/+439) zupT → / ← ribB zinc transporter/3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase
RA 3,176,820 G→T 100% intergenic (+138/+352) zupT → / ← ribB zinc transporter/3,4‑dihydroxy‑2‑butanone‑4‑phosphate synthase
RA 3,182,647 G→T 100% pseudogene (1868/2445 nt) yqiG → pseudogene; fimbrial export usher family;putative membrane; Not classified; putative membrane protein
RA 3,182,732 T→A 36.4% pseudogene (1953/2445 nt) yqiG → pseudogene; fimbrial export usher family;putative membrane; Not classified; putative membrane protein
RA 3,184,211 C→A 100% S74Y (TCT→TAT)  yqiI → fimbrial protein
RA 3,186,181 G→C 57.5% W205C (TGG→TGC yqiJ → DUF1449 family inner membrane protein
RA 3,189,569 C→A 69.0% D182Y (GAT→TAT)  hldE ← fused heptose 7‑phosphate kinase/heptose 1‑phosphate adenyltransferase
RA 3,193,329 G→T 5.8% G332G (GGC→GGA ygiF ← inorganic triphosphatase
RA 3,199,743 C→A 100% intergenic (‑128/‑79) ttdR ← / → ttdA transcriptional activator of ttdABT/L‑tartrate dehydratase, alpha subunit
RA 3,201,209 C→A 100% F160L (TTC→TTA ttdB → L‑tartrate dehydratase, beta subunit
RA 3,205,512 A→C 7.5% L349L (CTA→CTC dnaG → DNA primase
RA 3,212,264 G→T 34.2% H58N (CAC→AAC)  aer ← fused signal transducer for aerotaxis sensory component/methyl accepting chemotaxis component
RA 3,217,289 A→T 100% H433L (CAC→CTC)  ebgA → evolved beta‑D‑galactosidase, alpha subunit
RA 3,224,927 C→A 100% intergenic (+329/‑97) ygjK → / → fadH alpha‑glucosidase/2,4‑dienoyl‑CoA reductase, NADH and FMN‑linked
RA 3,230,857 C→G 100% A63G (GCC→GGC)  ygjR → putative NAD(P)‑dependent dehydrogenase
RA 3,231,349 A→C 100% Q227P (CAG→CCG)  ygjR → putative NAD(P)‑dependent dehydrogenase
RA 3,238,152 C→T 8.8% intergenic (‑52/‑311) uxaC ← / → exuT uronate isomerase/hexuronate transporter
RA 3,238,283 C→A 100% intergenic (‑183/‑180) uxaC ← / → exuT uronate isomerase/hexuronate transporter
RA 3,243,768 C→T 100% intergenic (+33/‑153) yqjK → / → yqjF uncharacterized protein/putative quinol oxidase subunit
RA 3,245,848 G→T 100% L62L (CTG→CTT yhaH → DUF805 family inner membrane protein
RA 3,246,619 Δ1 bp 71.4% coding (350/357 nt) yhaI → DUF805 family inner membrane protein
RA 3,249,474 C→A 58.2% T179T (ACG→ACT yhaM ← putative L‑serine dehydratase alpha chain
RA 3,252,258 C→A 100% D251Y (GAT→TAT)  tdcG ← L‑serine dehydratase 3, anaerobic
RA 3,254,752 C→A 100% V342V (GTG→GTT tdcE ← pyruvate formate‑lyase 4/2‑ketobutyrate formate‑lyase
RA 3,258,871 G→T 100% L173I (CTC→ATC)  tdcB ← L‑threonine dehydratase, catabolic
RA 3,261,001 G→A 100% intergenic (+44/‑212) tdcR → / → yhaB L‑threonine dehydratase operon activator protein/uncharacterized protein
RA 3,263,409 C→T 100% intergenic (+448/+166) yhaC → / ← rnpB pentapetide repeats‑related protein/RNase P, M1 RNA component
RA 3,263,502 C→T 5.8% intergenic (+541/+73) yhaC → / ← rnpB pentapetide repeats‑related protein/RNase P, M1 RNA component
RA 3,266,646 C→A 100% G91C (GGT→TGT)  garL ← alpha‑dehydro‑beta‑deoxy‑D‑glucarate aldolase
RA 3,268,357 C→A 100% intergenic (‑91/‑284) garP ← / → garD putative (D)‑galactarate transporter/(D)‑galactarate dehydrogenase
RA 3,271,128 A→C 100% T145P (ACC→CCC)  yhaV → toxin of the SohB(PrlF)‑YhaV toxin‑antitoxin system
RA 3,273,402 C→T 10.5% S377L (TCA→TTA)  kbaZ → tagatose 6‑phosphate aldolase 1, kbaZ subunit
RA 3,275,210 A→G 100% intergenic (+226/‑125) agaA → / → agaS pseudogene, N‑acetylgalactosamine‑6‑phosphate deacetylase fragment; putative N‑acetylgalactosamine‑6‑phosphate deacetylase/tagatose‑6‑phosphate ketose/aldose isomerase
RA 3,290,634 C→A 5.8% M288I (ATG→ATT yraQ ← putative inner membrane permease
RA 3,290,970 A→T 100% R176R (CGT→CGA yraQ ← putative inner membrane permease
RA 3,295,911 C→A 100% Q22K (CAG→AAG)  yhbV → U32 peptidase family protein
RA 3,296,612 G→T 100% A255A (GCG→GCT yhbV → U32 peptidase family protein
RA 3,299,240 A→C 100% intergenic (‑64/+90) mtr ← / ← deaD tryptophan transporter of high affinity/ATP‑dependent RNA helicase
RA 3,302,027 G→T 100% S86* (TCG→TAG)  nlpI ← lipoprotein involved in osmotic sensitivity and filamentation
RA 3,306,165 C→A 70.2% V125F (GTT→TTT)  rbfA ← 30s ribosome binding factor
RA 3,307,024 C→A 23.8% G784C (GGT→TGT)  infB ← translation initiation factor IF‑2
RA 3,312,055 C→A 100% G20G (GGC→GGA argG → argininosuccinate synthetase
RA 3,314,870 C→A 100% A35S (GCG→TCG)  yhbX ← putative EptAB family phosphoethanolamine transferase, inner membrane protein
RA 3,317,805 C→A 73.2% D156Y (GAT→TAT)  folP ← 7,8‑dihydropteroate synthase
RA 3,319,509 A→T 5.0% A262A (GCT→GCA ftsH ← protease, ATP‑dependent zinc‑metallo
RA 3,332,963 C→A 100% A154A (GCG→GCT mlaF ← ABC transporter maintaining OM lipid asymmetry, ATP‑binding protein
RA 3,334,464 C→A 100% S277R (AGC→AGA yrbG → putative calcium/sodium:proton antiporter
RA 3,334,687 G→T 100% A21A (GCG→GCT kdsD → D‑arabinose 5‑phosphate isomerase
RA 3,334,940 T→G 67.0% S106A (TCT→GCT)  kdsD → D‑arabinose 5‑phosphate isomerase
RA 3,340,038 C→A 24.1% I34I (ATC→ATA ptsN → sugar‑specific enzyme IIA component of PTS
RA 3,343,975 C→A 100% noncoding (40/121 nt) arcZ → sRNA positive antisense regulator of rpoS; binds Hfq
RA 3,345,801 A→T 6.6% L195Q (CTG→CAG)  arcB ← aerobic respiration control sensor histidine protein kinase, cognate to two‑component response regulators ArcA and RssB
RA 3,347,644 G→A 7.9% intergenic (‑235/‑440) yhcC ← / → gltB putative Fe‑S oxidoreductase, Radical SAM superfamily protein/glutamate synthase, large subunit
RA 3,347,778 G→A 100% intergenic (‑369/‑306) yhcC ← / → gltB putative Fe‑S oxidoreductase, Radical SAM superfamily protein/glutamate synthase, large subunit
RA 3,350,663 C→A 23.3% T860T (ACC→ACA gltB → glutamate synthase, large subunit
RA 3,351,650 G→T 100% E1189D (GAG→GAT gltB → glutamate synthase, large subunit
RA 3,354,405 C→T 100% intergenic (+430/‑130) gltD → / → gltF glutamate synthase, 4Fe‑4S protein, small subunit/periplasmic protein
RA 3,355,202 T→A 6.7% L223* (TTA→TAA)  gltF → periplasmic protein
RA 3,365,607 G→T 100% I109I (ATC→ATA nanT ← sialic acid transporter
RA 3,373,441 A→C 42.8% intergenic (‑85/‑109) yhcM ← / → yhcB putative AFG1‑like family P‑loop ATPase/DUF1043 family inner membrane‑anchored protein
RA 3,373,457 C→A 100% intergenic (‑101/‑93) yhcM ← / → yhcB putative AFG1‑like family P‑loop ATPase/DUF1043 family inner membrane‑anchored protein
RA 3,373,985 C→A 100% intergenic (+37/‑117) yhcB → / → degQ DUF1043 family inner membrane‑anchored protein/serine endoprotease, periplasmic
RA 3,375,260 G→T 100% D387Y (GAT→TAT)  degQ → serine endoprotease, periplasmic
RA 3,381,943 C→A 27.7% T181T (ACG→ACT aaeA ← p‑hydroxybenzoic acid efflux system component
RA 3,384,761 A→C 6.4% G209G (GGT→GGG tldD ← putative peptidase
RA 3,384,766 A→C 19.8% F208V (TTT→GTT)  tldD ← putative peptidase
RA 3,385,516 A→T 7.4% intergenic (‑129/+301) tldD ← / ← yhdP putative peptidase/DUF3971‑AsmA2 domains protein
RA 3,385,662 C→G 6.2% intergenic (‑275/+155) tldD ← / ← yhdP putative peptidase/DUF3971‑AsmA2 domains protein
RA 3,385,696 T→A 5.2% intergenic (‑309/+121) tldD ← / ← yhdP putative peptidase/DUF3971‑AsmA2 domains protein
RA 3,392,594 A→C 8.7% A248A (GCT→GCG mreC ← cell wall structural complex MreBCD transmembrane component MreC
RA 3,396,082 G→T 100% R204S (CGT→AGT)  csrD ← targeting factor for csrBC sRNA degradation
RA 3,402,321 C→A 13.6% I452I (ATC→ATA panF → pantothenate:sodium symporter
RA 3,403,534 C→T 100% intergenic (+224/‑105) prmA → / → dusB methyltransferase for 50S ribosomal subunit protein L11/tRNA‑dihydrouridine synthase B
RA 3,404,059 C→A 100% R141S (CGC→AGC)  dusB → tRNA‑dihydrouridine synthase B
RA 3,407,007 G→A 100% intergenic (‑183/‑216) acrS ← / → acrE acrAB operon transcriptional repressor/cytoplasmic membrane lipoprotein
RA 3,407,969 C→A 100% N249K (AAC→AAA acrE → cytoplasmic membrane lipoprotein
RA 3,409,856 A→C 100% T489P (ACC→CCC)  acrF → multidrug efflux system protein
RA 3,411,250 G→T 100% E953D (GAG→GAT acrF → multidrug efflux system protein
RA 3,415,112 C→A 10.6% G143G (GGC→GGA yhdY → putative amino‑acid transporter subunit
RA 3,415,702 T→A 28.4% L340Q (CTG→CAG)  yhdY → putative amino‑acid transporter subunit
RA 3,416,666 T→G 7.5% intergenic (+113/+116) yhdZ → / ← rrfF putative amino‑acid transporter subunit/5S ribosomal RNA of rrnD operon
RA 3,416,890 T→G 7.2% noncoding (12/120 nt) rrfF ← 5S ribosomal RNA of rrnD operon
RA 3,422,726 G→T 100% V44V (GTG→GTT yrdA → bacterial transferase hexapeptide domain protein
RA 3,424,363 T→A 100% T138S (ACC→TCC)  tsaC ← tRNA(ANN) t(6)A37 threonylcarbamoyladenosine modification protein, threonine‑dependent ADP‑forming ATPase
RA 3,433,098 G→T 23.5% F87L (TTC→TTA rplQ ← 50S ribosomal subunit protein L17
RA 3,440,151 G→T 100% I31I (ATC→ATA rpsN ← 30S ribosomal subunit protein S14
RA 3,440,444 G→T 100% S118S (TCC→TCA rplE ← 50S ribosomal subunit protein L5
RA 3,440,832 T→C 100% N99D (AAC→GAC)  rplX ← 50S ribosomal subunit protein L24
RA 3,445,410 C→A 100% R79L (CGT→CTT)  rplD ← 50S ribosomal subunit protein L4
RA 3,448,742 C→A 100% E6* (GAA→TAA)  gspA ← general secretory pathway component, cryptic
RA 3,449,105 C→A 5.1% Q57K (CAG→AAG)  gspC → general secretory pathway component, cryptic
RA 3,453,433 T→A 17.5% G86G (GGT→GGA gspF → general secretory pathway component, cryptic
RA 3,455,867 C→A 100% I55I (ATC→ATA gspJ → putative general secretory pathway component, cryptic
RA 3,455,930 C→A 100% I76I (ATC→ATA gspJ → putative general secretory pathway component, cryptic
RA 3,459,603 A→T 67.6% intergenic (+24/+5) gspO → / ← bfr bifunctional prepilin leader peptidase/ methylase/bacterioferritin, iron storage and detoxification protein
RA 3,461,433 C→A 9.3% D594Y (GAC→TAC)  chiA ← periplasmic endochitinase
RA 3,466,238 A→T 8.0% V212V (GTT→GTA fusA ← protein chain elongation factor EF‑G, GTP‑binding
RA 3,470,272 C→A 100% V169V (GTG→GTT fkpA ← FKBP‑type peptidyl‑prolyl cis‑trans isomerase (rotamase)
RA 3,471,705 C→T 100% G51D (GGT→GAT)  slyD ← FKBP‑type peptidyl prolyl cis‑trans isomerase (rotamase)
RA 3,473,139 G→T 100% I276I (ATC→ATA kefB ← potassium:proton antiporter
RA 3,475,255 C→A 100% S203Y (TCT→TAT)  yheS → putative transporter subunit of ABC superfamily: ATP‑binding component
RA 3,475,763 G→T 14.5% A372A (GCG→GCT yheS → putative transporter subunit of ABC superfamily: ATP‑binding component
RA 3,479,769 A→T 100% E97D (GAA→GAT crp → cAMP‑activated global transcription factor, mediator of catabolite repression
RA 3,487,342 C→T 100% intergenic (+234/‑28) tsgA → / → nirB putative transporter/nitrite reductase, large subunit, NAD(P)H‑binding
RA 3,488,966 G→C 100% A533P (GCC→CCC)  nirB → nitrite reductase, large subunit, NAD(P)H‑binding
RA 3,489,397 C→A 100% F676L (TTC→TTA nirB → nitrite reductase, large subunit, NAD(P)H‑binding
RA 3,493,210 C→T 23.2% intergenic (+236/‑59) yhfL → / → frlA small lipoprotein/putative fructoselysine transporter
RA 3,498,214 T→G 7.3% intergenic (+72/+80) frlR → / ← yhfS putative DNA‑binding transcriptional regulator/FNR‑regulated pyridoxal phosphate‑dependent aminotransferase family protein
RA 3,498,239 A→C 6.0% intergenic (+97/+55) frlR → / ← yhfS putative DNA‑binding transcriptional regulator/FNR‑regulated pyridoxal phosphate‑dependent aminotransferase family protein
RA 3,498,240 A→C 7.9% intergenic (+98/+54) frlR → / ← yhfS putative DNA‑binding transcriptional regulator/FNR‑regulated pyridoxal phosphate‑dependent aminotransferase family protein
RA 3,501,571 C→A 100% G127C (GGC→TGC)  php ← phosphotriesterase homology protein
RA 3,504,143 G→T 100% R65S (CGT→AGT)  yhfX ← putative pyridoxal 5'‑phosphate binding protein
RA 3,507,749 G→T 100% H224N (CAT→AAT)  rpe ← D‑ribulose‑5‑phosphate 3‑epimerase
RA 3,509,102 G→T 100% S57R (AGC→AGA dam ← DNA adenine methyltransferase
RA 3,512,321 A→T 10.8% S35T (TCC→ACC)  aroK ← shikimate kinase I
RA 3,513,424 A→T 100% V213V (GTT→GTA hofQ ← DNA catabolic putative fimbrial transporter
RA 3,518,052 C→A 26.3% P608Q (CCG→CAG)  mrcA → fused penicillin‑binding protein 1a: murein transglycosylase/murein transpeptidase
RA 3,519,188 C→A 100% L107L (CTG→CTT nudE ← adenosine nucleotide hydrolase; substrates include Ap3A, Ap2A, ADP‑ribose, NADH
RA 3,519,657 G→T 100% intergenic (‑149/‑171) nudE ← / → yrfF adenosine nucleotide hydrolase; substrates include Ap3A, Ap2A, ADP‑ribose, NADH/inner membrane protein
RA 3,528,406 G→T 100% I274I (ATC→ATA envZ ← sensory histidine kinase in two‑component regulatory system with OmpR
RA 3,535,370 C→A 100% S535R (AGC→AGA feoB → fused ferrous iron transporter, protein B: GTP‑binding protein/membrane protein
RA 3,538,583 C→A 29.7% R115S (CGC→AGC)  gntX → DNA catabolic protein
RA 3,543,793 G→T 9.2% T680T (ACC→ACA malP ← maltodextrin phosphorylase
RA 3,543,959 G→T 100% A625E (GCG→GAG)  malP ← maltodextrin phosphorylase
RA 3,545,077 C→A 29.1% L252L (CTG→CTT malP ← maltodextrin phosphorylase
JC 3,547,418 Δ28 bp 9.9% coding (975‑1002/2706 nt) malT → mal regulon transcriptional activator
RA 3,547,635 A→T 5.7% K398* (AAG→TAG)  malT → mal regulon transcriptional activator
RA 3,549,090 C→A 49.3% R883S (CGC→AGC)  malT → mal regulon transcriptional activator
RA 3,561,574 C→A 100% W372L (TGG→TTG)  glgC ← glucose‑1‑phosphate adenylyltransferase
RA 3,565,147 A→T 10.1% F572L (TTT→TTA glgB ← 1,4‑alpha‑glucan branching enzyme
RA 3,566,100 G→T 25.5% R255S (CGC→AGC)  glgB ← 1,4‑alpha‑glucan branching enzyme
RA 3,567,059 C→A 100% intergenic (‑197/+76) glgB ← / ← asd 1,4‑alpha‑glucan branching enzyme/aspartate‑semialdehyde dehydrogenase, NAD(P)‑binding
RA 3,571,015 C→T 10.4% intergenic (‑63/+76) gntK ← / ← gntR gluconate kinase 2/d‑gluconate inducible gluconate regulon transcriptional repressor
RA 3,571,153 C→A 100% E312* (GAA→TAA)  gntR ← d‑gluconate inducible gluconate regulon transcriptional repressor
RA 3,575,032 C→A 100% intergenic (+46/‑191) yhhY → / → yhhZ putative acetyltransferase/putative Hcp1 family polymorphic toxin protein; putative colicin‑like DNase/tRNase activity
RA 3,576,745 G→T 20.4% pseudogene (348/381 nt) yrhA → pseudogene, interrupted by IS1E
RA 3,577,827 A→G 28.0% intergenic (+158/‑292) yrhA → / → yrhB pseudogene, interrupted by IS1E/stable heat shock chaperone
RA 3,582,807 G→T 100% P194Q (CCG→CAG)  ugpE ← glycerol‑3‑phosphate transporter subunit
RA 3,590,636 G→T 100% Y95* (TAC→TAA livK ← leucine transporter subunit
RA 3,590,906 C→A 100% A5A (GCG→GCT livK ← leucine transporter subunit
RA 3,591,957 T→G 100% V354V (GTA→GTC livJ ← leucine/isoleucine/valine transporter subunit
RA 3,594,268 C→T 100% intergenic (‑125/+120) rpoH ← / ← ftsX RNA polymerase, sigma 32 (sigma H) factor/inner membrane putative ABC superfamily transporter permease
RA 3,596,266 C→A 100% T446T (ACG→ACT ftsY ← Signal Recognition Particle (SRP) receptor
RA 3,598,440 C→A 100% N34K (AAC→AAA yhhL → DUF1145 family protein
RA 3,601,909 C→A 60.6% T700K (ACG→AAG)  zntA → zinc, cobalt and lead efflux system
RA 3,602,081 A→C 7.3% intergenic (+72/+30) zntA → / ← tusA zinc, cobalt and lead efflux system/mnm(5)‑s(2)U34‑tRNA 2‑thiolation sulfurtransferase
RA 3,604,608 C→A 28.1% A162A (GCG→GCT yhhS ← putative arabinose efflux transporter
RA 3,607,110 C→A 100% I28I (ATC→ATA nikA → nickel‑binding, heme‑binding periplasmic protein
RA 3,612,284 G→T 100% D113Y (GAT→TAT)  nikR → transcriptional repressor, Ni‑binding
RA 3,618,536 C→A 100% R267R (CGG→AGG)  yhhI → putative transposase
RA 3,622,058 C→A 100% D281Y (GAT→TAT)  rbbA ← ribosome‑associated ATPase: ATP‑binding protein/ATP‑binding membrane protein
RA 3,629,424 T→A 100% intergenic (+171/+144) yhiM → / ← yhiN acid resistance protein, inner membrane/putative oxidoreductase
RA 3,630,577 T→A 13.1% Q65L (CAG→CTG)  yhiN ← putative oxidoreductase
RA 3,634,060 A→G 6.7% intergenic (+155/‑162) uspA → / → dtpB universal stress global response regulator/dipeptide and tripeptide permease B
RA 3,637,274 C→A 13.4% M423I (ATG→ATT prlC ← oligopeptidase A
RA 3,638,641 C→A 100% intergenic (‑99/‑104) prlC ← / → rlmJ oligopeptidase A/23S rRNA m(6)A2030 methyltransferase, SAM‑dependent
RA 3,639,239 G→T 100% P165P (CCG→CCT rlmJ → 23S rRNA m(6)A2030 methyltransferase, SAM‑dependent
RA 3,644,531 G→A 100% intergenic (+509/‑120) arsC → / → yhiS arsenate reductase/pseudogene
RA 3,646,984 G→T 100% pseudogene (394/483 nt) yhiS → pseudogene
RA 3,649,460 T→A 60.5% K65* (AAA→TAA)  hdeB ← acid‑resistance protein
RA 3,649,797 C→A 100% E102* (GAA→TAA)  hdeA ← stress response protein acid‑resistance protein
RA 3,657,375 G→A 100% P202S (CCT→TCT)  gadW ← transcriptional activator of gadA and gadBC; repressor of gadX
RA 3,659,083 T→A 63.9% N30Y (AAT→TAT)  gadX ← acid resistance regulon transcriptional activator; autoactivator
RA 3,661,610 A→T 100% F313L (TTT→TTA yhjA ← putative cytochrome C peroxidase
RA 3,662,660 T→C 100% intergenic (‑112/‑292) yhjA ← / → treF putative cytochrome C peroxidase/cytoplasmic trehalase
RA 3,664,901 C→A 11.2% A118A (GCG→GCT yhjB ← putative DNA‑binding transcriptional response regulator
RA 3,665,383 G→T 19.6% intergenic (‑129/‑391) yhjB ← / → yhjC putative DNA‑binding transcriptional response regulator/LysR family putative transcriptional regulator
RA 3,667,555 C→A 69.8% I278I (ATC→ATA yhjD → inner membrane putative BrbK family alternate lipid exporter
RA 3,667,959 C→A 100% intergenic (+224/‑187) yhjD → / → yhjE inner membrane putative BrbK family alternate lipid exporter/MFS superfamily sugar transport 1 family protein
RA 3,674,442 G→T 12.6% R287S (CGT→AGT)  yhjJ ← putative periplasmic M16 family chaperone
RA 3,674,730 C→A 23.9% D191Y (GAT→TAT)  yhjJ ← putative periplasmic M16 family chaperone
RA 3,676,851 G→A 7.1% intergenic (‑44/+139) dctA ← / ← yhjK C4‑dicarboxylic acid, orotate and citrate transporter/cyclic‑di‑GMP phosphodiesterase
RA 3,679,301 T→G 100% Q1078P (CAG→CCG)  bcsC ← cellulose synthase subunit
RA 3,679,324 C→A 100% M1070I (ATG→ATT bcsC ← cellulose synthase subunit
RA 3,679,463 T→A 9.0% Y1024F (TAC→TTC)  bcsC ← cellulose synthase subunit
RA 3,680,910 G→T 100% H542N (CAT→AAT)  bcsC ← cellulose synthase subunit
RA 3,686,345 C→A 100% R751L (CGC→CTC)  bcsA ← cellulose synthase, catalytic subunit
RA 3,692,994 T→A 100% F474Y (TTC→TAC)  bcsG → DUF3260 family inner membrane protein associated with cellulose production
RA 3,693,083 G→T 70.3% V504F (GTT→TTT)  bcsG → DUF3260 family inner membrane protein associated with cellulose production
RA 3,698,119 C→A 100% M1M (ATG→ATT) † dppC ← dipeptide/heme transporter
RA 3,698,875 G→T 100% F92L (TTC→TTA dppB ← dipeptide/heme transporter
RA 3,711,448 T→A 6.4% L260Q (CTG→CAG)  ghrB → glyoxylate/hydroxypyruvate reductase B
RA 3,717,788 C→A 100% P297P (CCG→CCT glyQ ← glycine tRNA synthetase, alpha subunit
RA 3,721,485 T→G 7.3% Y416S (TAC→TCC)  xylB ← xylulokinase
RA 3,722,763 C→A 19.3% intergenic (‑32/+40) xylB ← / ← xylA xylulokinase/D‑xylose isomerase
RA 3,723,822 C→A 8.3% D102Y (GAT→TAT)  xylA ← D‑xylose isomerase
RA 3,727,580 C→A 100% A167A (GCC→GCA xylH → D‑xylose ABC transporter permease subunit
RA 3,729,221 C→A 25.9% R295S (CGT→AGT)  xylR → xylose divergent operon transcriptional activator
RA 3,729,325 C→A 18.8% T329T (ACC→ACA xylR → xylose divergent operon transcriptional activator
RA 3,732,549 G→T 26.1% D565Y (GAT→TAT)  malS → alpha‑amylase
RA 3,735,263 C→A 6.4% A210A (GCG→GCT yiaJ ← transcriptional repressor of yiaK‑S operon
RA 3,736,722 C→A 100% G210G (GGC→GGA yiaK → 2,3‑diketo‑L‑gulonate reductase, NADH‑dependent
RA 3,738,088 T→A 26.6% F134Y (TTC→TAC)  yiaM → 2,3‑diketo‑L‑gulonate TRAP transporter small permease protein
RA 3,738,431 C→A 100% P90T (CCA→ACA)  yiaN → 2,3‑diketo‑L‑gulonate TRAP transporter large permease protein
RA 3,751,135 G→T 67.3% S18* (TCA→TAA)  yiaY ← putative Fe‑containing alcohol dehydrogenase, Pfam00465 family
RA 3,751,360 C→T 18.1% intergenic (‑173/+17) yiaY ← / ← selB putative Fe‑containing alcohol dehydrogenase, Pfam00465 family/selenocysteinyl‑tRNA‑specific translation factor
RA 3,755,723 G→T 78.3% E61* (GAA→TAA)  rhsA → Rhs family protein, putative polymorphic toxin; putative polysaccharide synthesis/export protein; putative neighboring cell growth inhibitor
RA 3,767,000 G→T 100% D454Y (GAC→TAC)  mtlA → fused mannitol‑specific PTS enzymes: IIA components/IIB components/IIC components
RA 3,767,085 T→A 5.9% L482Q (CTG→CAG)  mtlA → fused mannitol‑specific PTS enzymes: IIA components/IIB components/IIC components
RA 3,767,242 G→T 6.4% A534A (GCG→GCT mtlA → fused mannitol‑specific PTS enzymes: IIA components/IIB components/IIC components
RA 3,767,410 G→T 100% V590V (GTG→GTT mtlA → fused mannitol‑specific PTS enzymes: IIA components/IIB components/IIC components
RA 3,772,732 G→T 26.5% A107S (GCC→TCC)  lldR → dual role activator/repressor for lldPRD operon
RA 3,779,281 C→G 5.8% A221G (GCT→GGT)  gpmM → phosphoglycero mutase III, cofactor‑independent
RA 3,779,319 G→T 7.5% E234* (GAA→TAA)  gpmM → phosphoglycero mutase III, cofactor‑independent
RA 3,780,573 C→A 28.0% R126S (CGT→AGT)  envC → activator of AmiB,C murein hydrolases, septal ring factor
RA 3,782,439 G→T 27.4% R335S (CGC→AGC)  waaH ← LPS(HepIII)‑glucuronic acid glycosyltransferase
RA 3,783,727 C→A 25.9% A327S (GCT→TCT)  tdh ← L‑threonine 3‑dehydrogenase, NAD(P)‑binding
RA 3,783,857 A→T 56.3% I283I (ATT→ATA tdh ← L‑threonine 3‑dehydrogenase, NAD(P)‑binding
RA 3,784,878 A→T 20.6% L345Q (CTG→CAG)  kbl ← glycine C‑acetyltransferase
RA 3,785,915 G→T 100% intergenic (‑4/+271) kbl ← / ← yibB glycine C‑acetyltransferase/YibB family protein, function unknown
RA 3,786,687 C→A 6.5% L119F (TTG→TTT yibB ← YibB family protein, function unknown
RA 3,789,229 T→A 12.2% V314E (GTG→GAG)  waaF → ADP‑heptose:LPS heptosyltransferase II
RA 3,789,381 C→A 100% L15I (CTC→ATC)  waaC → ADP‑heptose:LPS heptosyl transferase I
RA 3,798,582 C→A 20.6% Q243H (CAG→CAT waaP ← kinase that phosphorylates core heptose of lipopolysaccharide
RA 3,805,743 T→A 6.5% L59F (TTA→TTT yicR ← UPF0758 family protein
RA 3,810,195 C→A 100% R54S (CGT→AGT)  yicC → UPF0701 family protein
RA 3,816,601 A→T 100% H281L (CAC→CTC)  spoT → bifunctional (p)ppGpp synthetase II/ guanosine‑3',5'‑bis pyrophosphate 3'‑pyrophosphohydrolase
RA 3,817,604 G→T 27.5% V615V (GTG→GTT spoT → bifunctional (p)ppGpp synthetase II/ guanosine‑3',5'‑bis pyrophosphate 3'‑pyrophosphohydrolase
RA 3,818,010 C→A 100% H46N (CAT→AAT)  trmH → tRNA mG18‑2'‑O‑methyltransferase, SAM‑dependent
RA 3,822,339 A→C 6.6% Q12P (CAA→CCA) ‡ xanP → xanthine permease
RA 3,822,340 A→C 16.5% Q12H (CAA→CAC) ‡ xanP → xanthine permease
RA 3,824,948 T→A 29.3% W378R (TGG→AGG)  yicH → putative inner membrane‑anchored periplasmic AsmA family protein
RA 3,825,702 C→A 100% K732N (AAG→AAT yicI ← putative alpha‑glucosidase
RA 3,826,247 A→T 65.4% Y551N (TAC→AAC)  yicI ← putative alpha‑glucosidase
RA 3,828,206 T→A 100% S362C (AGT→TGT)  yicJ ← putative transporter
RA 3,830,197 C→A 100% intergenic (+281/‑116) yicT → / → setC pseudogene/putative arabinose efflux transporter
RA 3,830,311 G→T 100% intergenic (+395/‑2) yicT → / → setC pseudogene/putative arabinose efflux transporter
RA 3,830,819 T→G 100% F169L (TTT→TTG setC → putative arabinose efflux transporter
RA 3,832,140 C→A 12.2% T178K (ACG→AAG)  yicL → EamA family inner membrane putative transporter
RA 3,832,308 G→C 24.3% S234T (AGT→ACT)  yicL → EamA family inner membrane putative transporter
RA 3,833,664 C→A 58.7% S30S (TCC→TCA yicS → putative periplasmic protein
RA 3,837,532 C→A 68.0% P70Q (CCG→CAG)  ade → cryptic adenine deaminase
RA 3,839,798 C→A 100% D244Y (GAT→TAT)  uhpT ← hexose phosphate transporter
JC 3,841,409 +CAACCAG 100% coding (576/1320 nt) uhpC ← membrane protein regulates uhpT expression
RA 3,842,467 C→A 28.6% G344W (GGG→TGG)  uhpB ← sensory histidine kinase in two‑component regulatory sytem with UhpA
RA 3,846,672 T→C 8.0% intergenic (‑55/‑241) istR ← / → tisB sRNA antisense regulators IstR‑1 and IstR‑2, affectr tisB, Hfq‑dependent/toxic membrane persister formation peptide, LexA‑regulated
RA 3,859,476 G→T 5.8% T53K (ACA→AAA)  yidE ← putative transporter
RA 3,860,159 C→A 100% P33P (CCG→CCT ibpB ← heat shock chaperone
RA 3,860,327 C→A 100% intergenic (‑70/+42) ibpB ← / ← ibpA heat shock chaperone/heat shock chaperone
RA 3,860,653 C→A 100% E44* (GAA→TAA)  ibpA ← heat shock chaperone
RA 3,861,553 C→A 100% G373C (GGC→TGC)  yidR ← DUF3748 family protein
RA 3,863,438 G→T 100% M234I (ATG→ATT cbrA → colicin M resistance protein; FAD‑binding protein, putative oxidoreductase
RA 3,865,120 C→A 100% intergenic (‑30/+90) dgoT ← / ← dgoD D‑galactonate transporter/galactonate dehydratase
RA 3,865,863 T→A 100% T166S (ACC→TCC)  dgoD ← galactonate dehydratase
RA 3,870,977 T→A 5.4% intergenic (‑152/+88) yidB ← / ← gyrB DUF937 family protein/DNA gyrase, subunit B
RA 3,871,008 G→T 13.8% intergenic (‑183/+57) yidB ← / ← gyrB DUF937 family protein/DNA gyrase, subunit B
RA 3,871,587 G→T 28.2% N631K (AAC→AAA gyrB ← DNA gyrase, subunit B
RA 3,872,006 T→A 100% S492C (AGC→TGC)  gyrB ← DNA gyrase, subunit B
RA 3,873,695 C→A 56.9% R296L (CGG→CTG)  recF ← gap repair protein
RA 3,875,148 C→A 29.4% A178A (GCG→GCT dnaN ← DNA polymerase III, beta subunit
RA 3,875,671 G→A 28.0% T4I (ACC→ATC)  dnaN ← DNA polymerase III, beta subunit
RA 3,877,722 A→T 7.8% V9V (GTA→GTT rpmH → 50S ribosomal subunit protein L34
RA 3,880,731 G→T 100% D182Y (GAT→TAT)  mnmE → tRNA U34 5‑methylaminomethyl‑2‑thiouridine modification GTPase
RA 3,882,377 C→A 56.4% T96T (ACC→ACA tnaA → tryptophanase/L‑cysteine desulfhydrase, PLP‑dependent
RA 3,886,162 T→G 8.6% L13R (CTG→CGG)  yidZ → putative DNA‑binding transcriptional regulator
RA 3,888,274 C→A 69.5% P88Q (CCG→CAG)  chrR → chromate reductase, Class I, flavoprotein
RA 3,890,808 A→T 29.6% intergenic (+9/‑58) yieH → / → cbrB phosphoenolpyruvate and 6‑phosphogluconate phosphatase/PRK09823 family inner membrane protein, creBC regulon
RA 3,890,960 T→A 100% F32Y (TTC→TAC)  cbrB → PRK09823 family inner membrane protein, creBC regulon
RA 3,891,618 A→T 12.5% I79I (ATA→ATT cbrC → UPF0167 family protein
RA 3,892,304 C→A 100% P150P (CCG→CCT yieK ← putative 6‑phosphogluconolactonase
RA 3,895,987 T→G 18.1% I359L (ATT→CTT)  bglB ← cryptic phospho‑beta‑glucosidase B
RA 3,901,415 C→A 100% P104P (CCG→CCT pstB ← phosphate transporter subunit
RA 3,901,867 T→G 6.2% intergenic (‑141/+42) pstB ← / ← pstA phosphate transporter subunit/phosphate transporter subunit
RA 3,902,074 C→A 5.0% M242I (ATG→ATT pstA ← phosphate transporter subunit
RA 3,904,553 T→A 100% P111P (CCA→CCT pstS ← periplasmic phosphate binding protein, high‑affinity
RA 3,904,977 A→T 56.6% intergenic (‑92/+222) pstS ← / ← glmS periplasmic phosphate binding protein, high‑affinity/L‑glutamine:D‑fructose‑6‑phosphate aminotransferase
RA 3,906,384 G→T 100% I215I (ATC→ATA glmS ← L‑glutamine:D‑fructose‑6‑phosphate aminotransferase
RA 3,906,459 G→T 5.9% I190I (ATC→ATA glmS ← L‑glutamine:D‑fructose‑6‑phosphate aminotransferase
RA 3,910,416 C→A 100% R107L (CGT→CTT)  atpD ← F1 sector of membrane‑bound ATP synthase, beta subunit
RA 3,910,448 G→T 100% V96V (GTC→GTA atpD ← F1 sector of membrane‑bound ATP synthase, beta subunit
RA 3,910,894 C→A 100% M244I (ATG→ATT atpG ← F1 sector of membrane‑bound ATP synthase, gamma subunit
RA 3,916,830 C→A 100% D71Y (GAT→TAT)  rsmG ← 16S rRNA m(7)G527 methyltransferase, SAM‑dependent; glucose‑inhibited cell‑division protein
RA 3,917,554 C→A 100% L480L (CTG→CTT mnmG ← 5‑methylaminomethyl‑2‑thiouridine modification at tRNA U34
RA 3,922,770 C→A 12.3% R65L (CGA→CTA)  viaA ← stimulator of RavA ATPase activity; von Willebrand factor domain protein
RA 3,923,028 C→A 100% D476Y (GAC→TAC)  ravA ← hexameric AAA+ MoxR family ATPase, putative molecular chaperone
RA 3,925,821 G→T 24.1% S382S (TCG→TCT kup → potassium transporter
RA 3,926,831 G→T 100% D41Y (GAT→TAT)  rbsD → putative cytoplasmic sugar‑binding protein
RA 3,927,972 G→T 100% E279* (GAA→TAA)  rbsA → fused D‑ribose transporter subunits of ABC superfamily: ATP‑binding components
RA 3,928,761 G→T 22.0% P38P (CCG→CCT rbsC → D‑ribose transporter subunit
RA 3,931,021 C→A 100% A123E (GCG→GAG)  rbsK → ribokinase
RA 3,931,898 G→T 6.1% M104I (ATG→ATT rbsR → transcriptional repressor of ribose metabolism
RA 3,932,241 G→T 7.0% D219Y (GAT→TAT)  rbsR → transcriptional repressor of ribose metabolism
RA 3,935,100 G→T 100% intergenic (‑413/‑68) yieP ← / → rrsC putative transcriptional regulator/16S ribosomal RNA of rrnC operon
RA 3,936,831 C→A 100% noncoding (37/76 nt) gltU → tRNA‑Glu
RA 3,936,834 G→T 20.8% noncoding (40/76 nt) gltU → tRNA‑Glu
RA 3,945,181 G→T 100% pseudogene (280/663 nt) ilvG → pseudogene, acetolactate synthase 2 large subunit, valine‑insensitive; acetolactate synthase II, large subunit, cryptic, interrupted
RA 3,946,256 A→T 7.8% Q138L (CAG→CTG)  ilvE → branched‑chain amino‑acid aminotransferase
RA 3,952,817 T→G 12.6% intergenic (+12/+75) ilvC → / ← ppiC ketol‑acid reductoisomerase, NAD(P)‑binding/peptidyl‑prolyl cis‑trans isomerase C (rotamase C)
RA 3,952,842 A→C 10.2% intergenic (+37/+50) ilvC → / ← ppiC ketol‑acid reductoisomerase, NAD(P)‑binding/peptidyl‑prolyl cis‑trans isomerase C (rotamase C)
RA 3,952,861 T→A 14.0% intergenic (+56/+31) ilvC → / ← ppiC ketol‑acid reductoisomerase, NAD(P)‑binding/peptidyl‑prolyl cis‑trans isomerase C (rotamase C)
RA 3,954,364 G→T 57.3% D110Y (GAT→TAT)  rep → DNA helicase and single‑stranded DNA‑dependent ATPase
RA 3,959,351 G→T 100% P77P (CCG→CCT trxA → thioredoxin 1
RA 3,960,036 G→A 100% R87H (CGC→CAC)  rho → transcription termination factor
RA 3,966,854 C→A 100% R325S (CGT→AGT)  rffG → dTDP‑glucose 4,6‑dehydratase
RA 3,967,387 G→T 6.9% P140P (CCG→CCT rffH → glucose‑1‑phosphate thymidylyltransferase
RA 3,967,474 G→T 100% A169A (GCG→GCT rffH → glucose‑1‑phosphate thymidylyltransferase
RA 3,967,504 A→C 8.0% K179N (AAA→AAC rffH → glucose‑1‑phosphate thymidylyltransferase
RA 3,968,414 G→T 5.0% A196A (GCG→GCT wecD → TDP‑fucosamine acetyltransferase
RA 3,969,710 G→T 100% G25C (GGT→TGT)  wzxE → O‑antigen translocase
RA 3,972,296 G→T 100% E112D (GAG→GAT wzyE → putative ECA polysaccharide chain elongation protein
RA 3,973,393 C→A 8.0% A26A (GCC→GCA wecG → UDP‑N‑acetyl‑D‑mannosaminuronic acid transferase
RA 3,983,298 G→T 29.9% R277S (CGC→AGC)  hemC ← hydroxymethylbilane synthase
RA 3,988,075 T→A 100% V65E (GTG→GAG)  yifL → putative lipoprotein
RA 3,990,354 C→A 6.3% H236Q (CAC→CAA xerC → site‑specific tyrosine recombinase
RA 3,993,534 A→G 27.8% intergenic (+29/+118) uvrD → / ← yigE DNA‑dependent ATPase I and helicase II/DUF2233 family protein
RA 3,993,566 A→G 15.0% intergenic (+61/+86) uvrD → / ← yigE DNA‑dependent ATPase I and helicase II/DUF2233 family protein
RA 3,994,076 A→T 100% L114* (TTA→TAA)  yigE ← DUF2233 family protein
RA 3,994,247 A→T 100% V57E (GTG→GAG)  yigE ← DUF2233 family protein
RA 3,996,346 T→A 100% I70F (ATC→TTC)  yigG ← PRK11371 family inner membrane protein
RA 4,001,612 G→T 6.1% V166F (GTC→TTC)  rhtC → threonine efflux pump
RA 4,008,459 C→A 9.5% P683T (CCA→ACA)  metE → 5‑methyltetrahydropteroyltriglutamate‑ homocysteine S‑methyltransferase
RA 4,009,705 G→A 100% intergenic (‑176/‑86) ysgA ← / → udp putative carboxymethylenebutenolidase/uridine phosphorylase
RA 4,012,953 C→A 58.8% R247S (CGT→AGT)  ubiE → bifunctional 2‑octaprenyl‑6‑methoxy‑1,4‑benzoquinone methylase/ S‑adenosylmethionine:2‑DMK methyltransferase
RA 4,020,049 C→G 28.8% P55A (CCG→GCG)  fre → NAD(P)H‑flavin reductase
RA 4,020,520 G→T 5.4% D212Y (GAT→TAT)  fre → NAD(P)H‑flavin reductase
RA 4,024,827 G→T 100% D103Y (GAT→TAT)  pepQ → proline dipeptidase
RA 4,034,118 G→T 31.2% intergenic (+122/+148) rrfA → / ← mobB 5S ribosomal RNA of rrnA operon/molybdopterin‑guanine dinucleotide biosynthesis protein B
RA 4,035,421 G→T 100% intergenic (‑62/‑8) mobA ← / → yihD molybdopterin‑guanine dinucleotide synthase/DUF1040 protein YihD
RA 4,036,012 G→T 27.4% D80Y (GAT→TAT)  srkA → stress response kinase A; MazF antagonist; Thr/Ser kinase involved in Cpx stress response
RA 4,037,484 T→A 100% intergenic (+80/‑75) dsbA → / → yihF periplasmic protein disulfide isomerase I/DUF945 family protein
RA 4,040,044 A→C 33.2% intergenic (‑82/‑282) yihG ← / → polA inner membrane protein, inner membrane acyltransferase/fused DNA polymerase I 5'‑>3' polymerase/3'‑>5' exonuclease/5'‑>3' exonuclease
RA 4,045,302 G→T 100% intergenic (+86/‑103) yihI → / → hemN activator of Der GTPase/coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent
RA 4,045,386 G→T 26.3% intergenic (+170/‑19) yihI → / → hemN activator of Der GTPase/coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent
RA 4,046,172 A→T 100% K256N (AAA→AAT hemN → coproporphyrinogen III oxidase, SAM and NAD(P)H dependent, oxygen‑independent
RA 4,053,774 G→T 28.4% intergenic (+184/‑33) typA → / → yihL GTP‑binding protein/putative DNA‑binding transcriptional regulator
RA 4,056,018 T→A 100% F138I (TTC→ATC)  yihN → MFS transporter family protein
RA 4,058,809 G→T 100% I106I (ATC→ATA yihO ← putative transporter
RA 4,062,424 G→T 100% I71I (ATC→ATA yihQ ← alpha‑glucosidase
RA 4,063,127 T→A 15.6% N212I (AAT→ATT)  yihR ← mutarotase superfamily protein, YihR family
RA 4,066,133 T→G 100% S267R (AGC→CGC)  yihU ← gamma‑hydroxybutyrate dehydrogenase, NADH‑dependent
RA 4,068,208 C→A 100% G60G (GGC→GGA yihW → DeoR family putative transcriptional regulator
RA 4,070,543 G→T 100% D57Y (GAT→TAT)  dtd → D‑tyr‑tRNA(Tyr) deacylase
RA 4,074,579 G→T 100% R4S (CGC→AGC)  fdhE ← formate dehydrogenase formation protein
RA 4,075,234 C→A 100% D296Y (GAC→TAC)  fdoH ← formate dehydrogenase‑O, Fe‑S subunit
RA 4,080,364 G→T 8.5% M1M (ATG→ATT) † yiiG → DUF3829 family lipoprotein
RA 4,088,850 C→A 100% R93S (CGT→AGT)  rhaR → transcriptional activator of rhaSR
RA 4,094,362 C→A 100% W181L (TGG→TTG)  cpxA ← sensory histidine kinase in two‑component regulatory system with CpxR
RA 4,097,822 G→T 100% E115* (GAA→TAA)  pfkA → 6‑phosphofructokinase I
RA 4,108,175 C→T 100% intergenic (‑157/‑268) glpF ← / → zapB glycerol facilitator/FtsZ stabilizer; septal ring assembly factor, stimulates cell division
RA 4,112,864 T→G 7.9% Q135P (CAG→CCG)  ftsN ← essential cell division protein
RA 4,117,673 G→T 11.0% T50T (ACC→ACA yiiX ← putative lipid binding hydrolase, DUF830 family protein
RA 4,122,248 A→T 100% intergenic (+53/‑296) metL → / → metF Bifunctional aspartokinase/homoserine dehydrogenase 2/5,10‑methylenetetrahydrofolate reductase
RA 4,124,384 C→A 100% H208N (CAT→AAT)  katG → catalase‑peroxidase HPI, heme b‑containing
RA 4,125,407 C→A 100% H549N (CAT→AAT)  katG → catalase‑peroxidase HPI, heme b‑containing
RA 4,127,022 T→G 100% E188D (GAA→GAC yijF ← DUF1287 family protein
RA 4,135,168 G→T 100% V416L (GTA→TTA)  pflD → putative glycine radical domain‑containing pyruvate formate‑lyase
RA 4,150,054 G→T 100% S222Y (TCT→TAT)  sthA ← pyridine nucleotide transhydrogenase, soluble
RA 4,150,645 A→T 7.1% L25Q (CTG→CAG)  sthA ← pyridine nucleotide transhydrogenase, soluble
RA 4,154,402 A→T 68.6% E279V (GAA→GTA)  btuB → vitamin B12/cobalamin outer membrane transporter
RA 4,158,143 A→T 36.2% intergenic (+15/‑157) rrsB → / → gltT 16S ribosomal RNA of rrnB operon/tRNA‑Glu
RA 4,158,149 T→C 36.7% intergenic (+21/‑151) rrsB → / → gltT 16S ribosomal RNA of rrnB operon/tRNA‑Glu
RA 4,158,400 G→A 18.8% intergenic (+25/‑169) gltT → / → rrlB tRNA‑Glu/23S ribosomal RNA of rrnB operon
RA 4,158,403 G→T 18.4% intergenic (+28/‑166) gltT → / → rrlB tRNA‑Glu/23S ribosomal RNA of rrnB operon
RA 4,158,404 A→G 18.3% intergenic (+29/‑165) gltT → / → rrlB tRNA‑Glu/23S ribosomal RNA of rrnB operon
RA 4,161,564 T→G 29.9% intergenic (+92/‑1) rrlB → / → rrfB 23S ribosomal RNA of rrnB operon/5S ribosomal RNA of rrnB operon
RA 4,163,117 T→A 69.7% I36I (ATT→ATA birA → bifunctional biotin‑[acetylCoA carboxylase] holoenzyme synthetase/ DNA‑binding transcriptional repressor, bio‑5'‑AMP‑binding
RA 4,172,507 C→A 100% I445I (ATC→ATA rpoB → RNA polymerase, beta subunit
RA 4,173,145 A→T 100% Q658L (CAG→CTG)  rpoB → RNA polymerase, beta subunit
RA 4,173,179 G→T 100% P669P (CCG→CCT rpoB → RNA polymerase, beta subunit
RA 4,176,823 G→T 100% D516Y (GAC→TAC)  rpoC → RNA polymerase, beta prime subunit
RA 4,178,969 G→T 100% R1231L (CGT→CTT)  rpoC → RNA polymerase, beta prime subunit
RA 4,184,471 A→T 73.5% I519I (ATT→ATA thiC ← phosphomethylpyrimidine synthase
RA 4,185,155 G→T 25.5% I291I (ATC→ATA thiC ← phosphomethylpyrimidine synthase
RA 4,190,061 T→A 68.4% intergenic (+39/‑148) yjaG → / → hupA DUF416 domain protein/HU, DNA‑binding transcriptional regulator, alpha subunit
RA 4,193,578 G→T 100% D111Y (GAT→TAT)  zraR → fused DNA‑binding response regulator in two‑component regulatory system with ZraS: response regulator/sigma54 interaction protein
RA 4,207,552 G→T 100% M172I (ATG→ATT aceA → isocitrate lyase
RA 4,210,753 C→A 100% E555* (GAA→TAA)  arpA ← ankyrin repeat protein
RA 4,211,576 G→T 100% S280R (AGC→AGA arpA ← ankyrin repeat protein
RA 4,211,803 G→A 100% P205S (CCT→TCT)  arpA ← ankyrin repeat protein
RA 4,213,578 C→A 24.8% intergenic (‑22/‑178) iclR ← / → metH transcriptional repressor/homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent
RA 4,214,563 A→T 100% T270S (ACC→TCC)  metH → homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent
RA 4,214,809 G→T 100% E352* (GAA→TAA)  metH → homocysteine‑N5‑methyltetrahydrofolate transmethylase, B12‑dependent
RA 4,219,790 A→T 69.9% L94Q (CTG→CAG)  pepE ← (alpha)‑aspartyl dipeptidase
RA 4,219,858 G→T 61.3% V71V (GTC→GTA pepE ← (alpha)‑aspartyl dipeptidase
RA 4,221,214 C→A 70.2% intergenic (+60/+73) rluF → / ← yjbD 23S rRNA pseudouridine(2604) synthase/DUF3811 family protein
RA 4,223,670 C→A 9.7% intergenic (‑509/‑16) lysC ← / → pgi lysine‑sensitive aspartokinase 3/glucosephosphate isomerase
RA 4,224,391 G→T 68.5% V236F (GTT→TTT)  pgi → glucosephosphate isomerase
RA 4,224,685 G→T 27.8% A334S (GCG→TCG)  pgi → glucosephosphate isomerase
RA 4,225,741 G→T 100% intergenic (+406/‑93) pgi → / → yjbE glucosephosphate isomerase/extracellular polysaccharide production threonine‑rich protein
RA 4,225,841 A→C 100% K3T (AAA→ACA)  yjbE → extracellular polysaccharide production threonine‑rich protein
RA 4,230,049 G→T 28.1% intergenic (‑66/‑204) yjbT ← / → psiE putative periplasmic protein/phosphate starvation inducible protein
RA 4,230,913 A→T 100% W424R (TGG→AGG)  xylE ← D‑xylose transporter
RA 4,235,869 G→T 100% A160E (GCG→GAG)  malE ← maltose transporter subunit
RA 4,235,916 G→T 100% N144K (AAC→AAA malE ← maltose transporter subunit
RA 4,236,666 C→A 100% intergenic (‑319/‑46) malE ← / → malK maltose transporter subunit/fused maltose transport subunit, ATP‑binding component of ABC superfamily/regulatory protein
RA 4,241,153 G→T 8.9% pseudogene (265/1323 nt) yjbI → pseudogene, SopA‑related, pentapeptide repeats‑containing
RA 4,242,509 C→T 100% L26F (CTC→TTC)  ubiC → chorismate‑‑pyruvate lyase
RA 4,244,663 G→T 56.5% H578N (CAC→AAC)  plsB ← glycerol‑3‑phosphate O‑acyltransferase
RA 4,245,537 G→T 100% N286K (AAC→AAA plsB ← glycerol‑3‑phosphate O‑acyltransferase
RA 4,247,370 G→T 13.8% D110Y (GAT→TAT)  lexA → transcriptional repressor of SOS regulon
RA 4,249,117 G→T 100% intergenic (+68/‑48) dinF → / → yjbJ oxidative stress resistance protein; putative MATE family efflux pump; UV and mitomycin C inducible protein/stress‑induced protein, UPF0337 family
RA 4,251,044 T→G 5.8% L173R (CTG→CGG)  yjbM → uncharacterized protein
RA 4,252,556 A→T 5.3% L320F (TTA→TTT dusA → tRNA‑dihydrouridine synthase A
RA 4,255,009 A→T 100% V256V (GTA→GTT dnaB → replicative DNA helicase
RA 4,258,754 T→A 12.9% T63S (ACG→TCG)  yjbS ← uncharacterized protein
RA 4,265,064 C→A 100% intergenic (‑95/‑335) yjcB ← / → yjcC putative inner membrane protein/putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA 4,265,089 T→A 100% intergenic (‑120/‑310) yjcB ← / → yjcC putative inner membrane protein/putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA 4,266,208 T→A 31.5% S270S (TCT→TCA yjcC → putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA 4,266,318 G→T 100% R307L (CGT→CTT)  yjcC → putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA 4,269,251 A→T 9.2% Q282L (CAG→CTG)  yjcD → inner membrane putative guanine permease
RA 4,269,869 C→A 28.4% intergenic (+113/‑39) yjcD → / → yjcE inner membrane putative guanine permease/putative cation/proton antiporter
RA 4,272,352 T→C 68.3% T218A (ACT→GCT)  yjcF ← pentapeptide repeats protein
RA 4,274,337 T→A 6.8% Q165L (CAG→CTG)  actP ← acetate transporter
RA 4,274,641 A→C 9.8% Y64D (TAC→GAC)  actP ← acetate transporter
RA 4,274,926 A→C 100% I72M (ATT→ATG yjcH ← DUF485 family inner membrane protein
RA 4,275,142 C→A 100% intergenic (‑1/+199) yjcH ← / ← acs DUF485 family inner membrane protein/acetyl‑CoA synthetase
RA 4,275,862 C→A 100% D480Y (GAT→TAT)  acs ← acetyl‑CoA synthetase
RA 4,279,816 G→T 72.8% A27A (GCG→GCT nrfC → formate‑dependent nitrite reductase, 4Fe4S subunit
RA 4,285,970 C→T 5.1% intergenic (+248/+283) gltP → / ← yjcO glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein
RA 4,288,086 G→T 100% F366L (TTC→TTA fdhF ← formate dehydrogenase‑H, selenopolypeptide subunit
RA 4,289,247 G→A 57.5% intergenic (‑64/+134) fdhF ← / ← mdtP formate dehydrogenase‑H, selenopolypeptide subunit/outer membrane factor of efflux pump
RA 4,290,080 G→T 100% I256I (ATC→ATA mdtP ← outer membrane factor of efflux pump
RA 4,297,485 G→C 100% G44G (GGC→GGG alsK ← D‑allose kinase
RA 4,297,846 C→A 100% M150I (ATG→ATT alsE ← allulose‑6‑phosphate 3‑epimerase
RA 4,303,614 T→A 100% *150R (TGA→AGA)  rpiB → ribose 5‑phosphate isomerase B/allose 6‑phosphate isomerase
RA 4,309,746 G→T 9.0% V245V (GTC→GTA phnI ← ribophosphonate triphosphate synthase complex putative catalytic subunit
RA 4,315,765 A→G 5.4% intergenic (‑207/+451) yjdN ← / ← yjdM metalloprotein superfamily protein/zinc‑ribbon family protein
RA 4,318,517 A→T 100% T522T (ACA→ACT crfC → clamp‑binding sister replication fork colocalization protein, dynamin‑related
RA 4,321,863 A→T 28.5% intergenic (+42/‑70) proP → / → pmrR proline/glycine betaine transporter/putative membrane‑bound BasS regulator
RA 4,329,774 C→A 100% D189Y (GAC→TAC)  adiA ← arginine decarboxylase
RA 4,330,426 Δ1 bp 100% intergenic (‑88/+111) adiA ← / ← melR arginine decarboxylase/melibiose operon transcriptional regulator; autoregulator
RA 4,337,551 C→A 29.3% V337V (GTG→GTT dcuB ← C4‑dicarboxylate transporter, anaerobic; DcuS co‑sensor
RA 4,337,927 A→T 53.4% V212E (GTA→GAA)  dcuB ← C4‑dicarboxylate transporter, anaerobic; DcuS co‑sensor
RA 4,341,023 A→T 100% Y153N (TAC→AAC)  dcuS ← sensory histidine kinase in two‑component regulatory system with DcuR, regulator of anaerobic fumarate respiration
RA 4,347,596 A→T 11.2% F280Y (TTC→TAC)  cadA ← lysine decarboxylase, acid‑inducible
RA 4,350,223 G→A 100% A510V (GCT→GTT)  cadC ← cadBA operon transcriptional activator
RA 4,352,529 C→A 12.3% intergenic (‑86/+21) pheU ← / ← yjdC tRNA‑Phe/putative transcriptional regulator
RA 4,356,198 A→T 10.1% S131S (TCT→TCA dcuA ← C4‑dicarboxylate antiporter
RA 4,358,390 A→C 100% intergenic (‑246/‑91) aspA ← / → fxsA aspartate ammonia‑lyase/suppressor of F exclusion of phage T7
RA 4,358,920 G→T 100% R147L (CGC→CTC)  fxsA → suppressor of F exclusion of phage T7
RA 4,359,686 C→A 30.2% E182* (GAA→TAA)  yjeH ← putative transporter
RA 4,366,322 A→C 100% intergenic (+63/‑48) ecnA → / → ecnB entericidin A membrane lipoprotein, antidote entericidin B/entericidin B membrane lipoprotein
RA 4,376,178 C→A 100% E1004* (GAA→TAA)  mscM ← mechanosensitive channel protein, miniconductance
RA 4,378,778 G→T 100% S137* (TCG→TAG)  mscM ← mechanosensitive channel protein, miniconductance
RA 4,380,610 G→T 12.2% I239I (ATC→ATA rsgA ← ribosome small subunit‑dependent GTPase A
RA 4,381,504 T→A 100% I28I (ATT→ATA orn → oligoribonuclease
RA 4,382,218 C→A 100% noncoding (42/76 nt) glyV → tRNA‑Gly
RA 4,384,268 C→A 13.2% S129* (TCG→TAG)  nnr → bifunctional NAD(P)H‑hydrate repair enzyme; C‑terminal domain ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase and N‑terminal domain NAD(P)H‑hydrate epimerase
RA 4,388,439 T→A 70.0% V404E (GTG→GAG)  mutL → methyl‑directed mismatch repair protein
RA 4,388,902 G→T 100% A558A (GCG→GCT mutL → methyl‑directed mismatch repair protein
RA 4,394,875 G→T 100% A124A (GCG→GCT purA → adenylosuccinate synthetase
RA 4,396,598 A→T 100% E43V (GAA→GTA)  rnr → exoribonuclease R, RNase R
RA 4,400,699 G→T 7.8% V110V (GTG→GTT yjfJ → PspA/IM30 family protein
RA 4,402,850 G→T 100% L2L (CTG→CTT yjfC → ATP‑Grasp family ATPase
RA 4,404,169 G→T 100% A26A (GCG→GCT aidB → DNA alkylation damage repair protein; flavin‑containing DNA binding protein, weak isovaleryl CoA dehydrogenase
RA 4,405,730 G→T 100% intergenic (+13/+104) aidB → / ← yjfN DNA alkylation damage repair protein; flavin‑containing DNA binding protein, weak isovaleryl CoA dehydrogenase/DUF1471 family periplasmic protein
RA 4,406,553 C→A 100% R12L (CGG→CTG)  bsmA ← bioflm peroxide resistance protein
RA 4,409,651 C→T 5.2% intergenic (‑209/‑146) ulaG ← / → ulaA L‑ascorbate 6‑phosphate lactonase/L‑ascorbate‑specific enzyme IIC permease component of PTS
RA 4,410,964 A→C 100% I390L (ATC→CTC)  ulaA → L‑ascorbate‑specific enzyme IIC permease component of PTS
RA 4,412,786 G→T 100% E42* (GAA→TAA)  ulaE → L‑xylulose 5‑phosphate 3‑epimerase
RA 4,417,122 G→T 100% R40S (CGT→AGT)  yjfZ ← uncharacterized protein
RA 4,417,551 A→C 100% pseudogene (41/402 nt) ytfA → pseudogene, related to transcriptional regulators
RA 4,427,647 G→A 100% D42N (GAT→AAT)  ytfI → uncharacterized protein
RA 4,428,092 G→T 100% G190V (GGA→GTA)  ytfI → uncharacterized protein
RA 4,432,031 G→A 100% intergenic (‑38/‑168) msrA ← / → tamA methionine sulfoxide reductase A/translocation and assembly module for autotransporter export, outer membrane subunit
RA 4,434,260 C→A 100% P111H (CCT→CAT)  tamB → translocation and assembly module for autotransporter export, inner membrane subunit
RA 4,436,662 G→T 28.6% G912C (GGT→TGT)  tamB → translocation and assembly module for autotransporter export, inner membrane subunit
RA 4,445,338 T→G 8.0% K30T (AAA→ACA)  fbp ← fructose‑1,6‑bisphosphatase I
RA 4,445,440 C→A 11.2% intergenic (‑14/‑162) fbp ← / → mpl fructose‑1,6‑bisphosphatase I/UDP‑N‑acetylmuramate:L‑alanyl‑gamma‑D‑glutamyl‑ meso‑diaminopimelate ligase
RA 4,445,719 A→T 100% T40S (ACC→TCC)  mpl → UDP‑N‑acetylmuramate:L‑alanyl‑gamma‑D‑glutamyl‑ meso‑diaminopimelate ligase
RA 4,456,233 G→T 100% I277I (ATC→ATA treR ← trehalose 6‑phosphate‑inducible trehalose regulon transcriptional repressor
RA 4,457,282 G→T 19.7% R12I (AGA→ATA)  mgtL → regulatory leader peptide for mgtA
RA 4,457,499 C→A 100% R20S (CGT→AGT)  mgtA → magnesium transporter
RA 4,458,254 T→A 100% V271V (GTT→GTA mgtA → magnesium transporter
RA 4,458,609 G→T 100% D390Y (GAT→TAT)  mgtA → magnesium transporter
RA 4,458,948 G→T 100% D503Y (GAT→TAT)  mgtA → magnesium transporter
RA 4,465,936 T→A 100% L228* (TTA→TAA)  yjgL → uncharacterized protein
RA 4,468,165 A→G 100% intergenic (‑37/‑125) argI ← / → rraB ornithine carbamoyltransferase 1/protein inhibitor of RNase E
RA 4,469,550 G→A 100% A2T (GCT→ACT)  yjgN → DUF898 family inner membrane protein
RA 4,470,017 G→A 100% M157I (ATG→ATA yjgN → DUF898 family inner membrane protein
RA 4,470,873 G→T 100% R928S (CGT→AGT)  valS ← valyl‑tRNA synthetase
RA 4,471,930 T→A 100% P575P (CCA→CCT valS ← valyl‑tRNA synthetase
RA 4,480,139 G→T 100% A273E (GCG→GAG)  idnR ← transcriptional repressor, 5‑gluconate‑binding
RA 4,493,435 T→C 100% intergenic (‑187/‑440) insG ← / → yjhB IS4 transposase/putative transporter
RA 4,494,721 G→A 100% A283T (GCC→ACC)  yjhB → putative transporter
RA 4,495,463 G→T 6.8% M120I (ATG→ATT yjhC → putative oxidoreductase
RA 4,495,859 T→G 100% D252E (GAT→GAG yjhC → putative oxidoreductase
RA 4,499,530 G→T 28.5% pseudogene (705/785 nt) insO → pseudogene, IS911 transposase B;IS, phage, Tn; Transposon‑related functions; extrachromosomal; transposon related
RA 4,505,141 G→T 100% R452S (CGT→AGT)  fecA ← ferric citrate outer membrane transporter
RA 4,512,693 T→A 100% K407* (AAG→TAG)  yjhG ← putative dehydratase
RA 4,513,759 T→A 6.0% G51G (GGA→GGT yjhG ← putative dehydratase
RA 4,520,701 G→T 100% G256G (GGC→GGA sgcX ← putative endoglucanase with Zn‑dependent exopeptidase domain
RA 4,523,001 T→A 100% intergenic (‑1/+55) yjhP ← / ← yjhQ putative methyltransferase/putative acetyltransferase
RA 4,525,234 G→A 100% pseudogene (415/1029 nt) yjhR → pseudogene, helicase family; putative frameshift suppressor
RA 4,531,143 A→T 100% I124F (ATT→TTT)  fimB → tyrosine recombinase/inversion of on/off regulator of fimA
RA 4,531,562 C→T 6.9% intergenic (+186/‑292) fimB → / → fimE tyrosine recombinase/inversion of on/off regulator of fimA/tyrosine recombinase/inversion of on/off regulator of fimA
RA 4,533,538 A→T 23.5% intergenic (+58/‑7) fimA → / → fimI major type 1 subunit fimbrin (pilin)/fimbrial protein involved in type 1 pilus biosynthesis
RA 4,536,446 A→T 29.8% K512* (AAG→TAG)  fimD → fimbrial usher outer membrane porin protein; FimCD chaperone‑usher
RA 4,541,306 C→T 24.1% intergenic (‑193/‑147) gntP ← / → uxuA fructuronate transporter/mannonate hydrolase
RA 4,541,449 A→T 100% intergenic (‑336/‑4) gntP ← / → uxuA fructuronate transporter/mannonate hydrolase
RA 4,543,413 G→T 5.3% A232A (GCG→GCT uxuB → D‑mannonate oxidoreductase, NAD‑dependent
RA 4,545,107 G→T 28.8% D239Y (GAT→TAT)  uxuR → fructuronate‑inducible hexuronate regulon transcriptional repressor; autorepressor
RA 4,545,608 C→A 100% R177I (AGA→ATA)  yjiC ← uncharacterized protein
RA 4,546,672 G→T 26.0% intergenic (‑535/‑138) yjiC ← / → iraD uncharacterized protein/RpoS stabilzer after DNA damage, anti‑RssB factor
RA 4,547,818 C→A 100% D97Y (GAT→TAT)  hypT ← hypochlorite‑responsive transcription factor
RA 4,548,084 A→T 76.7% L8* (TTG→TAG)  hypT ← hypochlorite‑responsive transcription factor
RA 4,555,156 G→T 100% A171E (GCG→GAG)  yjiM ← putative 2‑hydroxyglutaryl‑CoA dehydratase
RA 4,562,043 C→A 100% intergenic (+311/‑188) yjiS → / → yjiT DUF1127 family protein/pseudogene
RA 4,562,736 A→C 7.7% pseudogene (506/1503 nt) yjiT → pseudogene
RA 4,564,597 A→C 8.2% pseudogene (862/2937 nt) yjiV → pseudogene; conserved hypothetical protein
RA 4,567,278 G→T 100% I166I (ATC→ATA mcrC ← 5‑methylcytosine‑specific restriction enzyme McrBC, subunit McrC
RA 4,571,233 G→A 100% S16F (TCT→TTT)  hsdS ← specificity determinant for hsdM and hsdR
RA 4,572,520 A→T 100% Y116N (TAC→AAC)  hsdM ← DNA methyltransferase M
RA 4,575,840 A→C 8.4% pseudogene (793/3567 nt) hsdR ← pseudogene, premature stop codon, host restriction; endonuclease R
RA 4,584,255 A→C 100% L95L (CTT→CTG yjjL ← L‑galactonate transporter
RA 4,584,381 G→T 100% I53I (ATC→ATA yjjL ← L‑galactonate transporter
RA 4,584,756 A→T 100% *305K (TAA→AAA)  yjjM ← yjjMN operon transcriptional activator
RA 4,584,775 C→A 100% E298D (GAG→GAT yjjM ← yjjMN operon transcriptional activator
RA 4,585,213 G→T 7.5% F152L (TTC→TTA yjjM ← yjjMN operon transcriptional activator
RA 4,585,338 A→T 100% S111T (TCT→ACT)  yjjM ← yjjMN operon transcriptional activator
RA 4,588,180 G→T 100% S360* (TCA→TAA)  opgB ← phosphoglycerol transferases I and II
RA 4,589,130 G→T 100% I43I (ATC→ATA opgB ← phosphoglycerol transferases I and II
RA 4,591,139 C→A 100% D66Y (GAT→TAT)  dnaT ← DNA biosynthesis protein (primosomal protein I)
RA 4,596,243 T→A 100% intergenic (‑25/+243) leuQ ← / ← rsmC tRNA‑Leu/16S rRNA m(2)G1207 methyltransferase, SAM‑dependent
RA 4,596,487 T→A 37.6% *344L (TAA→TTA)  rsmC ← 16S rRNA m(2)G1207 methyltransferase, SAM‑dependent
RA 4,600,972 G→T 100% intergenic (+152/‑241) prfC → / → osmY peptide chain release factor RF‑3/periplasmic protein
RA 4,604,195 A→G 5.0% intergenic (+118/+302) yjjV → / ← yjjW putative DNase/putative pyruvate formate lyase activating enzyme
RA 4,604,320 T→C 5.2% intergenic (+243/+177) yjjV → / ← yjjW putative DNase/putative pyruvate formate lyase activating enzyme
RA 4,606,167 G→T 7.3% S239* (TCA→TAA)  yjjI ← DUF3029 family protein, putative glycine radical enzyme
RA 4,609,543 G→T 30.8% E42* (GAA→TAA)  deoB → phosphopentomutase
RA 4,615,947 G→T 100% E73D (GAG→GAT radA → DNA repair protein
RA 4,617,341 C→A 100% F70L (TTC→TTA nadR → trifunctional protein: nicotinamide mononucleotide adenylyltransferase, ribosylnicotinamide kinase, transcriptional repressor
RA 4,617,970 A→C 12.6% Q280P (CAG→CCG)  nadR → trifunctional protein: nicotinamide mononucleotide adenylyltransferase, ribosylnicotinamide kinase, transcriptional repressor
RA 4,625,288 T→C 100% intergenic (‑161/‑50) rob ← / → creA right oriC‑binding transcriptional activator, AraC family/putative periplasmic protein
RA 4,630,770 G→T 100% T4T (ACG→ACT yjtD → putative methyltransferase

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ CP009273 373832 375099 1268 200 [197] [196] 199 frmA–[frmR] frmA,[frmR]
* * ÷ CP009273 1191688 1206939 15252 199 [195] [198] 200 [icd]–[icdC] [icd],ymfD,ymfE,lit,intE,xisE,ymfI,ymfJ,cohE,croE,ymfL,ymfM,oweE,aaaE,ymfR,beeE,jayE,ymfQ,stfP,tfaP,tfaE,stfE,pinE,mcrA,[icdC]
* * ÷ CP009273 4100598 4101520 923 200 [193] [196] 199 [cdh]–tpiA [cdh],tpiA

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? CP009273 360104 =215 (0.710)157 (0.520) 88/278 NT 42.2% intergenic (‑38/+557) lacZ/lacI pseudogene, truncated/DNA‑binding transcriptional repressor
?CP009273 = 360286 NA (NA)intergenic (‑220/+375) lacZ/lacI pseudogene, truncated/DNA‑binding transcriptional repressor
* ? CP009273 = 360278NA (NA)8089 (28.220)
+TTAATTAA
195/262 NT 96.9% intergenic (‑212/+383) lacZ/lacI pseudogene, truncated/DNA‑binding transcriptional repressor
?CP009273 = 361823 272 (0.890)coding (831/834 nt) mhpR mhp operon transcriptional activator
* ? CP009273 360652 =317 (1.040)5916 (29.160)
+46 bp
186/186 NT 97.0% intergenic (‑586/+9) lacZ/lacI pseudogene, truncated/DNA‑binding transcriptional repressor
?CP009273 = 1317577 234 (0.770)coding (101/882 nt) yciV PHP domain protein
* ? CP009273 360652 =317 (1.040)1996 (9.840)
+46 bp
186/186 NT 91.6% intergenic (‑586/+9) lacZ/lacI pseudogene, truncated/DNA‑binding transcriptional repressor
?CP009273 = 1317577 234 (0.770)coding (101/882 nt) yciV PHP domain protein
* ? CP009273 = 361823272 (0.890)47 (0.160)
+TTAATTAA
7/262 NT 16.0% coding (831/834 nt) mhpR mhp operon transcriptional activator
?CP009273 4033991 = 251 (0.820)noncoding (115/120 nt) rrfA 5S ribosomal RNA of rrnA operon
* ? CP009273 376716 =NA (NA)293 (0.960) 158/278 NT 99.7% intergenic (‑1/‑91) yaiX/insC1 pseudogene, interrupted by IS2A, acetyltransferase homolog; nonfunctional; interruped by IS2; putative transferase/IS2 repressor TnpA
?CP009273 566411 = 1 (0.000)coding (63/552 nt) ybcL inactive polymorphonuclear leukocyte migration suppressor; DLP12 prophage; secreted protein, UPF0098 family
* ? CP009273 = 378046NA (NA)351 (1.150) 173/278 NT 99.7% intergenic (+11/+1) insD1/yaiX IS2 transposase TnpB/pseudogene, interrupted by IS2A, acetyltransferase homolog; nonfunctional; interruped by IS2; putative transferase
?CP009273 = 566415 1 (0.000)coding (67/552 nt) ybcL inactive polymorphonuclear leukocyte migration suppressor; DLP12 prophage; secreted protein, UPF0098 family
* ? CP009273 776825 =165 (0.540)27 (0.090)
+G
14/276 NT 12.7% noncoding (1/76 nt) lysZ tRNA‑Lys
?CP009273 = 2514488 208 (0.680)noncoding (216/1345 nt) IS186 repeat region
* ? CP009273 = 776902193 (0.630)10 (0.040) 4/238 NT 5.1% intergenic (+2/‑131) lysZ/lysQ tRNA‑Lys/tRNA‑Lys
?CP009273 777267 = 205 (0.790)intergenic (+159/‑274) lysQ/nadA tRNA‑Lys/quinolinate synthase, subunit A
* ? CP009273 777033 =199 (0.650)53 (0.180)
+G
3/276 NT 20.8% noncoding (1/76 nt) lysQ tRNA‑Lys
?CP009273 = 2514488 208 (0.680)noncoding (216/1345 nt) IS186 repeat region
* ? CP009273 1635219 =0 (0.000)374 (1.250) 164/274 NT 100% intergenic (‑377/+377) essQ/cspB Qin prophage; putative S lysis protein/Qin prophage; cold shock protein
?CP009273 = 2063752 NA (NA)noncoding (1/1331 nt) IS2 repeat region
* ? CP009273 = 16352230 (0.000)299 (0.980) 157/278 NT 100% intergenic (‑381/+373) essQ/cspB Qin prophage; putative S lysis protein/Qin prophage; cold shock protein
?CP009273 = 1645805 NA (NA)intergenic (+11/‑3) insD1/intQ IS2 transposase TnpB;IS, phage, Tn; Transposon‑related functions; extrachromosomal; transposon related/pseudogene, Qin prophage; phage integrase family;Phage or Prophage Related
* ? CP009273 = 2509092NA (NA)15 (0.050) 14/272 NT 5.0% intergenic (+170/+30) insL1/yfeA IS186 transposase/putative diguanylate cyclase
?CP009273 = 4533433 290 (0.950)coding (502/549 nt) fimA major type 1 subunit fimbrin (pilin)
* ? CP009273 3179455 =NA (NA)27 (0.090) 21/278 NT 9.3% intergenic (+7/‑91) yqiG/insC1 pseudogene; fimbrial export usher family;putative membrane; Not classified; putative membrane protein/IS2 repressor TnpA
?CP009273 = 4346539 263 (0.860)coding (1896/2148 nt) cadA lysine decarboxylase, acid‑inducible
* ? CP009273 = 3180783NA (NA)329 (1.100) 172/274 NT 97.7% pseudogene (4/2445 nt) yqiG pseudogene; fimbrial export usher family;putative membrane; Not classified; putative membrane protein
?CP009273 = 3833569 8 (0.030)intergenic (‑216/‑6) nlpA/yicS cytoplasmic membrane lipoprotein‑28/putative periplasmic protein
* ? CP009273 = 3180785NA (NA)25 (0.080) 18/278 NT 8.8% pseudogene (6/2445 nt) yqiG pseudogene; fimbrial export usher family;putative membrane; Not classified; putative membrane protein
?CP009273 4346535 = 258 (0.850)coding (1900/2148 nt) cadA lysine decarboxylase, acid‑inducible
* ? CP009273 3744959 =297 (0.980)158 (0.520) 99/278 NT 35.5% coding (270/741 nt) yiaT putative outer membrane protein
?CP009273 = 3752673 277 (0.910)coding (549/1845 nt) selB selenocysteinyl‑tRNA‑specific translation factor
* ? CP009273 3833562 =8 (0.030)316 (1.050) 163/276 NT 97.5% intergenic (‑209/‑13) nlpA/yicS cytoplasmic membrane lipoprotein‑28/putative periplasmic protein
?CP009273 4487999 = NA (NA)intergenic (+242/‑90) intB/insC1 pseudogene, integrase homology;IS, phage, Tn; Phage‑related functions and prophages; KpLE2 phage‑like element; P4‑like integrase/IS2 repressor TnpA