breseq  version 0.32.1  revision aa8f2595a244 mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence	position	mutation	annotation	gene	description
RA	7,925	+A	coding (35/1431 nt)	yaaJ ←	putative transporter
RA	10,647	A→G	V237A (GTC→GCC)	yaaW ←	UPF0174 family protein
RA	14,301	C→T	A45V (GCG→GTG)	dnaJ →	chaperone Hsp40, DnaK co‑chaperone
RA	28,269	C→T	intergenic (+62/‑105)	rihC → / → dapB	ribonucleoside hydrolase 3/dihydrodipicolinate reductase
RA	30,616	T→C	P322P (CCT→CCC)	carA →	carbamoyl phosphate synthetase small subunit, glutamine amidotransferase
RA	35,373	G→C	intergenic (‑2/+4)	caiE ← / ← caiD	stimulator of CaiD and CaiB enzyme activities/carnitinyl‑CoA dehydratase
RA	37,903	C→T	D405N (GAC→AAC)	caiB ←	crotonobetainyl CoA:carnitine CoA transferase
RA	47,776	G→A	*177* (TAG→TAA)  S3N (AGC→AAC)	kefF → kefC →	potassium‑efflux system ancillary protein for KefC, glutathione‑regulated, quinone oxidoreductase, FMN‑dependent potassium:proton antiporter
RA	49,765	C→T	intergenic (+134/‑58)	kefC → / → folA	potassium:proton antiporter/dihydrofolate reductase
RA	49,767	A→G	intergenic (+136/‑56)	kefC → / → folA	potassium:proton antiporter/dihydrofolate reductase
RA	66,447	T→C	E35G (GAG→GGG)	araD ←	L‑ribulose‑5‑phosphate 4‑epimerase
RA	66,614	T→A	intergenic (‑64/+221)	araD ← / ← araA	L‑ribulose‑5‑phosphate 4‑epimerase/L‑arabinose isomerase
RA	72,115	G→A	*255* (TAG→TAA)	yabI →	DedA family inner membrane protein
RA	72,229	C→T	*233* (TAG→TAA)	thiQ ←	thiamine/thiamine pyrophosphate ABC transporter ATPase
RA	75,447	A→G	C12R (TGC→CGC)	thiB ←	thiamine/thiamine pyrophosphate/thiamine monophosphate ABC transporter periplasmic binding protein
RA	84,735	A→G	D123G (GAC→GGC)	leuO →	global transcription factor
RA	96,008	G→A	*453* (TAG→TAA)  V3I (GTT→ATT)	murF → mraY →	UDP‑N‑acetylmuramoyl‑tripeptide:D‑alanyl‑D‑ alanine ligase phospho‑N‑acetylmuramoyl‑pentapeptide transferase
RA	104,352	A→G	E124G (GAG→GGG)	ftsA →	ATP‑binding cell division FtsK recruitment protein
RA	111,433	G→A	*130* (TAG→TAA)	mutT →	dGTP‑preferring nucleoside triphosphate pyrophosphohydrolase
RA	115,661	T→C	M22V (ATG→GTG)	hofC ←	assembly protein in type IV pilin biogenesis, transmembrane protein
RA	117,074	A→G	L9P (CTG→CCG)	hofB ←	T2SE secretion family protein, P‑loop ATPase superfamily protein
RA	117,798	A→G	L283P (CTA→CCA)	nadC ←	quinolinate phosphoribosyltransferase
RA	122,856	G→A	*255* (TAG→TAA)	pdhR →	pyruvate dehydrogenase complex repressor, autorepressor
RA	125,227	T→C	R737R (CGT→CGC)	aceE →	pyruvate dehydrogenase, decarboxylase component E1, thiamine triphosphate‑binding
RA	150,947	T→C	T3A (ACT→GCT)	yadC ←	putative fimbrial‑like adhesin protein
RA	152,036	C→T	V66I (GTA→ATA)	yadL ←	putative fimbrial‑like adhesin protein
RA	155,935	T→C	K89K (AAA→AAG)	yadV ←	putative periplasmic pilin chaperone
RA	160,782	C→T	*235* (TAG→TAA)	sfsA ←	sugar fermentation stimulation protein A
RA	162,927	G→A	A275T (GCT→ACT)	hrpB →	putative ATP‑dependent helicase
RA	167,743	C→T	T87I (ACC→ATC)	fhuA →	ferrichrome outer membrane transporter
RA	169,645	A→G	Y721C (TAC→TGC)	fhuA →	ferrichrome outer membrane transporter
RA	170,349	A→G	H191R (CAC→CGC)	fhuC →	iron(3+)‑hydroxamate import ABC transporter ATPase
RA	177,662	C→T	*267* (TAG→TAA)	btuF ←	vitamin B12 ABC transporter periplasmic binding protein
RA	183,215	C→T	G251G (GGC→GGT)	cdaR →	carbohydrate diacid regulon transcriptional regulator, autoregulator
RA	183,607	Δ1 bp	coding (1145/1158 nt)	cdaR →	carbohydrate diacid regulon transcriptional regulator, autoregulator
RA	183,620	G→A	*386* (TAG→TAA)	cdaR →	carbohydrate diacid regulon transcriptional regulator, autoregulator
RA	184,257	C→T	*271* (TAG→TAA)	yaeI ←	phosphodiesterase with model substrate bis‑pNPP
RA	197,574	T→C	S343S (AGT→AGC)	rseP →	inner membrane zinc RIP metalloprotease, RpoE activator, by degrading RseA, cleaved signal peptide endoprotease
RA	200,214	C→T	P763S (CCA→TCA)	bamA →	BamABCDE complex OM biogenesis outer membrane pore‑forming assembly factor
RA	219,364	T→C	P77P (CCA→CCG)	tsaA ←	tRNA‑Thr(GGU) m(6)t(6)A37 methyltransferase, SAM‑dependent
RA	220,239	C→T	L230L (CTG→CTA)	metQ ←	DL‑methionine transporter subunit
RA	239,378	G→A	pseudogene (273/273 nt)	yafF →	pseudogene, H repeat‑associated protein
RA	247,461	G→A	*250* (TAG→TAA)	yafL →	putative lipoprotein and C40 family peptidase
RA	247,466	Δ1 bp	intergenic (+5/‑171)	yafL → / → rayT	putative lipoprotein and C40 family peptidase/RAYT REP element‑mobilizing transposase, TnpA(REP)
RA	253,084	A→G	T126A (ACA→GCA)	yafP →	GNAT family putative N‑acetyltransferase
RA	255,659	A→G	C20R (TGT→CGT)	pepD ←	aminoacyl‑histidine dipeptidase (peptidase D)
MC JC	257,908	Δ776 bp		[crl]	[crl]
RA	262,563	G→A	R354H (CGT→CAT)	proA →	gamma‑glutamylphosphate reductase
RA	280,024	C→T	pseudogene (94/174 nt)	insI1 →	IS30 transposase,IS, phage, Tn, Transposon‑related functions, extrachromosomal, transposon related
RA	281,662	Δ1 bp	coding (322/1155 nt)	yagA ←	CP4‑6 prophage, putative DNA‑binding transcriptional regulator
RA	284,869	C→T	P557S (CCG→TCG)	yagF →	CP4‑6 prophage, dehydratase family protein
RA	287,977	A→G	M397V (ATG→GTG)	yagH →	CP4‑6 prophage, putative xylosidase/arabinosidase
RA	291,324	C→T	C8Y (TGT→TAT)	insA ←	IS1 repressor TnpA
RA	309,358	C→T	*223* (TAG→TAA)	ecpB ←	ECP production pilus chaperone
RA	309,486	C→T	G181S (GGT→AGT)	ecpB ←	ECP production pilus chaperone
RA	312,189	C→T	G26G (GGC→GGT)	ykgL →	uncharacterized protein
RA	315,244	G→A	intergenic (+16/‑47)	eaeH → / → insE1	pseudogene, attaching and effacing protein homology,factor, Not classified/IS3 transposase A
RA	316,453	G→A	*289* (TAG→TAA)	insF1 →	IS3 transposase B
RA	321,564	(G)7→6	intergenic (+483/‑44)	rclR → / → ykgE	reactive chlorine species (RCS)‑specific activator of the rcl genes/cysteine‑rich LutA family protein, putative electron transport chain YkgEFG component
RA	323,355	C→T	P340S (CCA→TCA)	ykgF →	ferridoxin‑like LutB family protein, putative electron transport chain YkgEFG component
RA	335,970	C→T	Q16* (CAA→TAA)	yahE →	DUF2877 family protein
RA	340,089	G→A	intergenic (+346/‑76)	yahG → / → yahI	DUF1116 family protein/carbamate kinase‑like protein
RA	344,674	T→C	Y167H (TAC→CAC)	yahL →	uncharacterized protein
RA	344,991	G→A	*272* (TAG→TAA)	yahL →	uncharacterized protein
RA	345,649	G→A	*82* (TAG→TAA)	yahM →	uncharacterized protein
RA	349,847	T→C	intergenic (+275/‑165)	prpB → / → prpC	2‑methylisocitrate lyase/2‑methylcitrate synthase
RA	354,592	G→A	*629* (TAG→TAA)	prpE →	propionate‑‑CoA ligase
RA	357,591	C→T	intergenic (+137/+200)	codA → / ← cynR	cytosine/isoguanine deaminase/transcriptional activator of cyn operon, autorepressor
RA	357,606	C→T	intergenic (+152/+185)	codA → / ← cynR	cytosine/isoguanine deaminase/transcriptional activator of cyn operon, autorepressor
RA	357,626	2 bp→TA	intergenic (+172/+164)	codA → / ← cynR	cytosine/isoguanine deaminase/transcriptional activator of cyn operon, autorepressor
RA	357,791	C→T	*300* (TAG→TAA)	cynR ←	transcriptional activator of cyn operon, autorepressor
RA	371,542	C→T	Q102* (CAA→TAA)	mhpC →	2‑hydroxy‑6‑ketonona‑2,4‑dienedioic acid hydrolase
RA	372,966	A→G	T16A (ACC→GCC)	mhpF →	acetaldehyde‑CoA dehydrogenase II, NAD‑binding
RA	375,067	A→G	intergenic (+186/‑392)	mhpE → / → mhpT	4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I/3‑hydroxyphenylpropionic transporter
RA	375,075	G→A	intergenic (+194/‑384)	mhpE → / → mhpT	4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I/3‑hydroxyphenylpropionic transporter
RA	375,307	C→T	intergenic (+426/‑152)	mhpE → / → mhpT	4‑hyroxy‑2‑oxovalerate/4‑hydroxy‑2‑oxopentanoic acid aldolase, class I/3‑hydroxyphenylpropionic transporter
RA	379,606	C→T	*92* (TAG→TAA)	frmR ←	regulator protein that represses frmRAB operon
RA	380,022	(G)10→11	intergenic (‑141/+47)	frmR ← / ← yaiO	regulator protein that represses frmRAB operon/outer membrane protein
RA	382,579	G→A	*302* (TAG→TAA)	insD1 →	IS2 transposase TnpB
RA	383,259	C→T	R226Q (CGG→CAG)	yaiP ←	putative family 2 glycosyltransferase
RA	384,059	C→T	*186* (TAG→TAA)	yaiS ←	putative PIG‑L family deacetylase
RA	385,737	A→G	D169G (GAT→GGT)	tauA →	taurine ABC transporter periplasmic binding protein
RA	391,739	C→T	*289* (TAG→TAA)	insF1 ←	IS3 transposase B
RA	401,548	(G)5→4	coding (163/261 nt)	iraP →	anti‑RssB factor, RpoS stabilzer during Pi starvation, anti‑adapter protein
RA	405,224	G→A	P141S (CCA→TCA)	proC ←	pyrroline‑5‑carboxylate reductase, NAD(P)‑binding
RA	411,297	C→T	*395* (TAG→TAA)	araJ ←	L‑arabinose‑inducible putative transporter, MFS family
RA	437,107	G→A	*173* (TAG→TAA)	pgpA →	phosphatidylglycerophosphatase A
RA	443,051	C→T	*197* (TAG→TAA)	yajL ←	oxidative‑stress‑resistance chaperone
RA	443,604	C→T	S13N (AGT→AAT)  *304* (TAG→TAA)	yajL ← panE ←	oxidative‑stress‑resistance chaperone 2‑dehydropantoate reductase, NADPH‑specific
RA	444,641	C→T	intergenic (‑126/‑42)	panE ← / → yajQ	2‑dehydropantoate reductase, NADPH‑specific/phage Phi6 host factor, ATP/GTP binding protein
RA	450,764	C→T	A283T (GCT→ACT)	cyoA ←	cytochrome o ubiquinol oxidase subunit II
RA	461,242	G→A	*785* (TAG→TAA)	lon →	DNA‑binding ATP‑dependent protease La
RA	468,510	A→G	E43G (GAG→GGG)	ybaO →	putative DNA‑binding transcriptional regulator
RA	469,429	A→G	K187E (AAG→GAG)	mdlA →	putative multidrug ABC transporter ATPase
RA	470,643	G→A	*591* (TAG→TAA)  S3N (AGT→AAT)	mdlA → mdlB →	putative multidrug ABC transporter ATPase putative multidrug ABC transporter ATPase
RA	475,667	T→C	S97P (TCA→CCA)	ybaY →	outer membrane lipoprotein
RA	477,025	G→A	*118* (TAG→TAA)	ybaA →	DUF1428 family protein
RA	477,435	T→C	T395A (ACT→GCT)	ylaB ←	putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA	478,533	C→T	A29T (GCC→ACC)	ylaB ←	putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA	480,334	C→T	*125* (TAG→TAA)	tomB ←	Hha toxicity attenuator, conjugation‑related protein
RA	486,641	T→C	S36P (TCA→CCA)	mscK →	mechanosensitive channel protein, intermediate conductance, K+ regulated
RA	490,285	C→T	*176* (TAG→TAA)	priC ←	primosomal replication protein N''
RA	491,776	T→C	V122A (GTT→GCT)	apt →	adenine phosphoribosyltransferase
RA	499,014	C→T	R320R (CGC→CGT)  *320* (TAG→TAA)	hemH → aes ←	ferrochelatase acetyl esterase
RA	515,808	C→T	intergenic (‑35/‑111)	qmcA ← / → fetA	PHB domain membrane‑anchored putative protease/iron export ABC transporter ATPase, peroxide resistance protein
RA	518,721	C→A	M143I (ATG→ATT)	ybbO ←	putative oxidoreductase
RA	522,463	T→C	V683A (GTG→GCG)	ybbP →	putative ABC transporter permease
RA	524,158	C→T	L300L (CTG→TTG)	rhsD →	Rhs protein with DUF4329 family putative toxin domain, putative neighboring cell growth inhibitor
RA	540,515	C→T	intergenic (+7/‑50)	allB → / → ybbY	allantoinase/putative uracil/xanthine transporter
RA	542,530	A→G	T215A (ACG→GCG)	glxK →	glycerate kinase II
RA	544,754	C→T	R180H (CGT→CAT)	allC ←	allantoate amidohydrolase
RA	551,332	G→A	*298* (TAG→TAA)	ybcF →	putative carbonate kinase
RA	568,004	G→A	*289* (TAG→TAA)	insF1 →	IS3 transposase B
RA	571,444	G→A	*184* (TAG→TAA)	ybcL →	inactive polymorphonuclear leukocyte migration suppressor, DLP12 prophage, UPF0098 family secreted protein
RA	572,454	C→T	C29C (TGC→TGT)	ylcH →	uncharacterized protein, DLP12 prophage
RA	578,568	G→A	*154* (TAG→TAA)	rzpD →	DLP12 prophage, putative murein endopeptidase
RA	582,148	Δ1 bp	intergenic (+51/+4)	tfaD → / ← ybcY	pseudogene, DLP12 prophage, tail fiber assembly protein family,Phage or Prophage Related/pseudogene, DLP12 prophage, methyltransferase homology,Phage or Prophage Related
RA	582,152	C→T	pseudogene (653/653 nt)	ybcY ←	pseudogene, DLP12 prophage, methyltransferase homology,Phage or Prophage Related
RA	586,280	T→C	N210S (AAC→AGC)	envY ←	porin thermoregulatory transcriptional activator
RA	607,988	G→A	*51* (TAG→TAA)	hokE →	toxic polypeptide, small
RA	631,812	T→C	F640S (TTC→TCC)	cstA →	carbon starvation protein involved in peptide utilization, APC peptide transporter family protein
RA	634,746	2 bp→AT		[ybdL]–[ybdM]	[ybdL], [ybdM]
RA	649,372	A→G	F67S (TTC→TCC)	citF ←	citrate lyase, citrate‑ACP transferase (alpha) subunit
RA	649,648	A→G	G281G (GGT→GGC)	citE ←	citrate lyase, citryl‑ACP lyase (beta) subunit
RA	662,153	C→A	E42D (GAG→GAT)	lipB ←	octanoyltransferase, octanoyl‑[ACP]:protein N‑octanoyltransferase
RA	664,102	C→T	*363* (TAG→TAA)	rlpA ←	septal ring protein, suppressor of prc, minor lipoprotein
RA	672,947	C→A	V613F (GTT→TTT)	leuS ←	leucyl‑tRNA synthetase
RA	675,570	C→T	*326* (TAG→TAA)	ybeQ ←	Sel1 family TPR‑like repeat protein
RA	675,601	Δ1 bp	coding (947/978 nt)	ybeQ ←	Sel1 family TPR‑like repeat protein
RA	677,889	G→A	A159T (GCC→ACC)	djlB →	putative HscC co‑chaperone, uncharacterized J domain‑containing protein
RA	679,874	G→A	G123R (GGG→AGG)	ybeU →	DUF1266 family protein
RA	696,276	G→A	*392* (TAG→TAA)	ubiF →	2‑octaprenyl‑3‑methyl‑6‑methoxy‑1,4‑benzoquinol oxygenase
RA	711,724	C→T	A59T (GCG→ACG)	ybfE ←	LexA‑regulated protein, CopB family
RA	716,388	C→T	pseudogene (210/651 nt)	ybfG ←	pseudogene
RA	723,528	(T)8→9	coding (887/2685 nt)	kdpD ←	fused sensory histidine kinase in two‑component regulatory system with KdpE: signal sensing protein
RA	738,853	G→A	*254* (TAG→TAA)	ybfD →	H repeat‑associated putative transposase
RA	746,723	C→T	H263H (CAC→CAT)  *349* (TAG→TAA)	nei → abrB ←	endonuclease VIII and 5‑formyluracil/5‑hydroxymethyluracil DNA glycosylase regulator of aidB expression, inner membrane protein
RA	746,726	G→A	*264* (TAG→TAA)  A348A (GCC→GCT)	nei → abrB ←	endonuclease VIII and 5‑formyluracil/5‑hydroxymethyluracil DNA glycosylase regulator of aidB expression, inner membrane protein
RA	762,739	G→A	*406* (TAG→TAA)	sucB →	dihydrolipoyltranssuccinase
RA	775,120	G→A	A123A (GCG→GCA)	ybgC →	acyl‑CoA thioester hydrolase
RA	777,644	A→G	intergenic (+37/‑96)	tolA → / → tolB	membrane anchored protein in TolA‑TolQ‑TolR complex/periplasmic protein
RA	789,464	G→A	I172I (ATC→ATT)	galK ←	galactokinase
RA	812,947	G→A	*226* (TAG→TAA)	bioD →	dethiobiotin synthetase
RA	819,747	G→A	*151* (TAG→TAA)	moaE →	molybdopterin synthase, large subunit
RA	821,506	G→A	*238* (TAG→TAA)	ybhM →	BAX Inhibitor‑1 family inner membrane protein
RA	825,102	G→A	A336V (GCG→GTG)	ybhR ←	putative ABC transporter permease
RA	826,119	C→T	*378* (TAG→TAA)	ybhS ←	putative ABC transporter permease
RA	829,972	C→T	M1M (GTG→ATG) † *224* (TAG→TAA)	ybhG ← ybiH ←	putative membrane fusion protein (MFP) component of efflux pump, membrane anchor DUF1956 domain‑containing tetR family putative transcriptional regulator
RA	850,389	T→C	intergenic (‑292/‑61)	rhtA ← / → ompX	threonine and homoserine efflux system/outer membrane protein X
RA	852,869	C→T	*43* (TAG→TAA)	mntS ←	Mn(2)‑response protein, MntR‑repressed
RA	854,765	G→A	*373* (TAG→TAA)	ybiR →	putative transporter
RA	855,796	A→G	intergenic (‑52/‑167)	ldtB ← / → ybiT	L,D‑transpeptidase linking Lpp to murein/ABC‑F family putative regulatory ATPase
RA	860,638	A→G	Y657H (TAT→CAT)	ybiW ←	putative pyruvate formate lyase
RA	872,801	G→A	*304* (TAG→TAA)	gsiD →	glutathione ABC transporter permease
RA	875,327	G→A	*783* (TAG→TAA)	yliE →	putative membrane‑anchored cyclic‑di‑GMP phosphodiesterase
RA	879,857	G→A	*372* (TAG→TAA)  S208S (AGC→AGT)	yliI → gstB ←	soluble aldose sugar dehydrogenase glutathione S‑transferase
JC JC	883,665	IS1 (–) +9 bp		[mdfA]	[mdfA]
RA	887,959	G→A	*179* (TAG→TAA)	rcdA →	transcriptional regulator of csgD and ybiJI, autoregulator
RA	889,215	A→G	L202P (CTG→CCG)	ybjL ←	putative transporter
RA	892,869	G→A	*301* (TAG→TAA)	rimK →	ribosomal protein S6 modification protein
RA	899,254	(G)6→7	coding (737/1128 nt)	rlmC →	23S rRNA m(5)U747 methyltransferase, SAM‑dependent
RA	905,743	G→A	*277* (TAG→TAA)  R337R (CGC→CGT)	amiD → ybjS ←	1,6‑anhydro‑N‑acetylmuramyl‑L‑alanine amidase, Zn‑dependent, OM lipoprotein putative NAD(P)H‑dependent oxidoreductase
RA	911,132	A→G	intergenic (‑83/+50)	poxB ← / ← hcr	pyruvate dehydrogenase, thiamine triphosphate‑binding, FAD‑binding/HCP oxidoreductase, NADH‑dependent
RA	913,349	G→A	L156L (CTG→TTG)	hcp ←	hybrid‑cluster [4Fe‑2S‑2O] subunit of anaerobic terminal reductases
RA	915,730	T→C	K106K (AAA→AAG)	aqpZ ←	aquaporin Z
RA	922,366	C→T	*75* (TAG→TAA)	cspD ←	inhibitor of DNA replication, cold shock protein homolog
RA	927,205	A→G	R76R (CGT→CGC)	aat ←	leucyl/phenylalanyl‑tRNA‑protein transferase
RA	932,340	(A)8→7	intergenic (‑290/‑255)	trxB ← / → lrp	thioredoxin reductase, FAD/NAD(P)‑binding/leucine‑responsive global transcriptional regulator
RA	937,983	G→A	*204* (TAG→TAA)	lolA →	lipoprotein chaperone
RA	966,584	G→A	*755* (TAG→TAA)	ycaI →	ComEC family inner membrane protein
RA	967,118	A→G	Q166Q (CAA→CAG)	msbA →	lipid ABC transporter permease/ATPase
RA	969,352	G→A	*329* (TAG→TAA)	lpxK →	lipid A 4'kinase
RA	983,623	G→A	*183* (TAG→TAA)	ycbK →	M15A protease‑related family periplasmic protein
RA	986,671	A→G	R104R (CGT→CGC)	ompF ←	outer membrane porin 1a (Ia,b,F)
RA	1,006,415	Δ1 bp	coding (464/543 nt)	zapC →	FtsZ stabilizer
RA	1,006,491	C→T	V180V (GTC→GTT)  *370* (TAG→TAA)	zapC → ycbX ←	FtsZ stabilizer 6‑N‑hydroxylaminopurine detoxification oxidoreductase
RA	1,050,350	C→A	S108S (TCC→TCA)	insB1 →	IS1 transposase B
RA	1,053,516	(G)6→7	coding (2663/2745 nt)	torS ←	hybrid sensory histidine kinase in two‑component regulatory system with TorR
RA	1,068,254	G→A	*58* (TAG→TAA)	ymdF →	KGG family protein
RA	1,068,276	Δ1 bp	intergenic (+22/+235)	ymdF → / ← rutG	KGG family protein/pyrimidine permease
RA	1,068,285	Δ1 bp	intergenic (+31/+226)	ymdF → / ← rutG	KGG family protein/pyrimidine permease
RA	1,072,060	G→A	L34L (CTG→TTG)	rutC ←	putative aminoacrylate deaminase, reactive intermediate detoxification, weak enamine/imine deaminase activity
RA	1,073,732	C→T	A94T (GCG→ACG)	rutA ←	pyrimidine oxygenase, FMN‑dependent
RA	1,082,060	A→G	pseudogene (601/726 nt)	efeU →	ferrous iron permease (pseudogene)
RA	1,089,570	T→C	E96E (GAA→GAG)	pgaB ←	poly‑beta‑1,6‑N‑acetyl‑D‑glucosamine (PGA) N‑deacetylase outer membrane export lipoprotein
RA	1,094,275	C→T	*289* (TAG→TAA)	insF1 ←	IS3 transposase B
RA	1,102,221	T→C	E107E (GAA→GAG)	csgE ←	curlin secretion specificity factor
RA	1,119,307	C→T	*47* (TAG→TAA)	yceO ←	uncharacterized protein
RA	1,125,011	A→G	C106R (TGC→CGC)	mdtH ←	multidrug resistance efflux transporter conferring overexpression resistance to norfloxacin and enoxacin
RA	1,139,406	Δ1 bp	coding (1029/1644 nt)	flgK →	flagellar hook‑filament junction protein 1
RA	1,146,011	C→T	*195* (TAG→TAA)	yceF ←	m(7)GTP pyrophosphatase
RA	1,148,691	G→A	*357* (TAG→TAA)	plsX →	putative phosphate acyltransferase
RA	1,149,712	G→A	*318* (TAG→TAA)	fabH →	3‑oxoacyl‑[acyl‑carrier‑protein] synthase III
RA	1,153,047	A→G	D370G (GAT→GGT)	fabF →	3‑oxoacyl‑[acyl‑carrier‑protein] synthase II
RA	1,154,109	G→A	*270* (TAG→TAA)	pabC →	4‑amino‑4‑deoxychorismate lyase component of para‑aminobenzoate synthase multienzyme complex
RA	1,168,350	Δ1 bp	coding (483/633 nt)	ycfQ ←	repressor for bhsA(ycfR)
RA	1,200,881	G→A	A51V (GCC→GTC)	xisE ←	e14 prophage, putative excisionase
RA	1,203,224	G→A	*67* (TAG→TAA)	croE →	e14 prophage, putative DNA‑binding transcriptional regulator
RA	1,204,160	G→A	*113* (TAG→TAA)	ymfM →	e14 prophage, uncharacterized protein
RA	1,205,731	G→A	*61* (TAG→TAA)  pseudogene (1/412 nt)	ymfR → beeE →	e14 prophage, uncharacterized protein pseudogene, portal protein family, e14 prophage,Phage or Prophage Related
RA	1,208,517	C→T	P129L (CCT→CTT)  *201* (TAG→TAA)	tfaP → tfaE ←	e14 prophage, uncharacterized protein e14 prophage, putative tail fiber assembly protein
RA	1,208,534	Δ1 bp	coding (403/414 nt);coding (586/603 nt)	tfaP → tfaE ←	e14 prophage, uncharacterized protein e14 prophage, putative tail fiber assembly protein
RA	1,211,652	C→T	intergenic (+75/+28)	icdC → / ← iraM	pseudogene, isocitrate dehydrogenase C‑terminal gene fragment, idcC' is a 54 codon 3' gene fragment created during e14 prophage insertion/RpoS stabilzer during Mg starvation, anti‑RssB factor
RA	1,212,233	A→G	intergenic (‑230/+470)	iraM ← / ← ycgX	RpoS stabilzer during Mg starvation, anti‑RssB factor/DUF1398 family protein
RA	1,212,703	C→T	*135* (TAG→TAA)	ycgX ←	DUF1398 family protein
RA	1,216,996	Δ2 bp		[ymgC]	[ymgC]
RA	1,228,724	A→G	T216A (ACT→GCT)	ycgM →	putative isomerase/hydrolase
RA	1,245,600	G→A	*147* (TAG→TAA)	ycgY →	uncharacterized protein
RA	1,250,629	(C)5→6	coding (210/1071 nt)	dhaK ←	dihydroxyacetone kinase, PTS‑dependent, dihydroxyacetone‑binding subunit
RA	1,252,038	G→A	A325T (GCT→ACT)	dhaR →	dhaKLM operon transcription activator
RA	1,260,528	A→G	I92I (ATT→ATC)	dauA ←	C4‑dicarboxylic acid transporter
RA	1,264,970	G→A	*419* (TAG→TAA)	hemA →	glutamyl tRNA reductase
MC JC	1,265,001	1086 bp→GAGG		[prfA]	[prfA]
RA	1,271,455	G→A	T132I (ACC→ATC)	chaA ←	calcium/sodium:proton antiporter
RA	1,275,815	T→C	E5E (GAA→GAG)	narL ←	response regulator in two‑component regulatory system with NarX
RA	1,286,793	A→G	intergenic (+267/+273)	narI → / ← rttR	nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
RA	1,286,796	T→C	intergenic (+270/+270)	narI → / ← rttR	nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
RA	1,286,805	2 bp→AA	intergenic (+279/+260)	narI → / ← rttR	nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
RA	1,286,831	T→A	intergenic (+305/+235)	narI → / ← rttR	nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
RA	1,286,859	T→C	intergenic (+333/+207)	narI → / ← rttR	nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
RA	1,286,984	G→A	intergenic (+458/+82)	narI → / ← rttR	nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
RA	1,287,152	T→C	noncoding (85/171 nt) T9A (ACT→GCT)	rttR ← tpr ←	rtT sRNA, processed from tyrT transcript protamine‑like protein
RA	1,287,161	2 bp→AA	noncoding (75‑76/171 nt) coding (15‑16/90 nt)	rttR ← tpr ←	rtT sRNA, processed from tyrT transcript protamine‑like protein
RA	1,309,016	C→T	*418* (TAG→TAA)	kch ←	voltage‑gated potassium channel
RA	1,317,517	A→G	I300T (ATC→ACC)	trpB ←	tryptophan synthase, beta subunit
RA	1,347,450	C→T	G488D (GGT→GAT)	rnb ←	ribonuclease II
RA	1,354,505	C→T	S5N (AGC→AAC)  *322* (TAG→TAA)	sapC ← sapB ←	antimicrobial peptide transport ABC transporter permease antimicrobial peptide transport ABC transporter permease
RA	1,366,935	C→T	*326* (TAG→TAA)	pspF ←	psp operon transcriptional activator
RA	1,370,044	(T)9→8	intergenic (+41/‑172)	pspE → / → ycjM	thiosulfate:cyanide sulfurtransferase (rhodanese)/alpha amylase catalytic domain family protein
RA	1,380,807	G→A	*220* (TAG→TAA)	ycjU →	beta‑phosphoglucomutase
RA	1,381,789	G→A	pseudogene (13/126 nt)	ycjV →	pseudogene, putative ATP‑binding component of a transport system
RA	1,389,242	C→T	Q105* (CAA→TAA)	ycjG →	L‑Ala‑D/L‑Glu epimerase
RA	1,389,499	C→T	C190C (TGC→TGT)	ycjG →	L‑Ala‑D/L‑Glu epimerase
RA	1,389,895	G→A	*322* (TAG→TAA)  P235L (CCT→CTT)	ycjG → mpaA ←	L‑Ala‑D/L‑Glu epimerase murein peptide amidase A
RA	1,392,890	G→A	*300* (TAG→TAA)	pgrR →	murein peptide degradation regulator
RA	1,399,985	(C)7→8	coding (252/516 nt)	ogt ←	O‑6‑alkylguanine‑DNA:cysteine‑protein methyltransferase
RA	1,400,348	G→A	P476S (CCC→TCC)	abgT ←	p‑aminobenzoyl‑glutamate transporter, membrane protein
RA	1,412,000	C→T	*412* (TAG→TAA)	intR ←	Rac prophage, integrase
RA	1,418,386	G→A	intergenic (‑157/‑285)	kilR ← / → sieB	killing protein, Rac prophage, FtsZ inhibitor protein/phage superinfection exclusion protein, Rac prophage
RA	1,419,159	G→A	*163* (TAG→TAA)  S51S (AGC→AGT)	sieB → ydaF ←	phage superinfection exclusion protein, Rac prophage uncharacterized protein, Rac prophage
RA	1,419,344	G→A	A38V (GCT→GTT)	ydaG ←	Rac prophage, uncharacterized protein
RA	1,425,228	(T)8→7	coding (1447/1458 nt)	trkG →	Rac prophage, potassium transporter subunit
RA	1,425,980	G→A	pseudogene (351/453 nt)	ydaY →	pseudogene, Rac prophage,Phage or Prophage Related
RA	1,426,288	G→A	intergenic (+206/‑166)	ydaY → / → tmpR	pseudogene, Rac prophage,Phage or Prophage Related/Rac prophage, pseudogene, tail protein family,Phage or Prophage Related, putative alpha helix protein
RA	1,431,882	T→C	V945A (GTG→GCG)	stfR →	Rac prophage, putative tail fiber protein
RA	1,432,273	G→A	A1075A (GCG→GCA)	stfR →	Rac prophage, putative tail fiber protein
RA	1,450,392	C→T	A320T (GCA→ACA)	tynA ←	tyramine oxidase, copper‑requiring
RA	1,454,292	C→A	G122G (GGC→GGA)	paaA →	ring 1,2‑phenylacetyl‑CoA epoxidase subunit
RA	1,458,617	A→G	A118A (GCA→GCG)	paaG →	1,2‑epoxyphenylacetyl‑CoA isomerase, oxepin‑CoA‑forming
RA	1,459,052	G→A	*263* (TAG→TAA)	paaG →	1,2‑epoxyphenylacetyl‑CoA isomerase, oxepin‑CoA‑forming
RA	1,464,489	G→A	*317* (TAG→TAA)  D7N (GAC→AAC)	paaX → paaY →	transcriptional repressor of phenylacetic acid degradation paa operon, phenylacetyl‑CoA inducer thioesterase required for phenylacetic acid degradation, trimeric, phenylacetate regulatory and detoxification protein, hexapeptide repeat protein
RA	1,466,996	T→C	pseudogene (1605/2513 nt)	ydbA →	pseudogene, autotransporter homolog, interrupted by IS2 and IS30
RA	1,467,921	C→T	*302* (TAG→TAA)	insD1 ←	IS2 transposase TnpB
RA	1,491,389	A→G	K163R (AAG→AGG)	cybB →	cytochrome b561
RA	1,493,219	A→G	E250E (GAA→GAG)	trg →	methyl‑accepting chemotaxis protein III, ribose and galactose sensor receptor
RA	1,497,308	A→G	E151E (GAA→GAG)	opgD →	OPG biosynthetic periplasmic protein
RA	1,503,125	G→A	*223* (TAG→TAA)	ydcL →	lipoprotein
RA	1,513,468	T→C	S218P (TCC→CCC)	ydcT →	putative ABC transporter ATPase
RA	1,529,938	G→A	pseudogene (2037/2037 nt) R6K (AGA→AAA)	rhsE → ydcD →	pseudogene, Rhs family putative immunity protein for RhsE
RA	1,533,045	C→T	intergenic (+93/‑7)	ydcC → / → pptA	H repeat‑associated putative transposase/4‑oxalocrotonate tautomerase
RA	1,544,384	C→T	pseudogene (381/381 nt)	yddK ←	pseudogene, leucine‑rich protein, putative glycoportein
RA	1,548,360	C→T	D320D (GAC→GAT)	fdnG →	formate dehydrogenase‑N, alpha subunit, nitrate‑inducible
RA	1,557,112	C→T	*309* (TAG→TAA)	ddpF ←	D,D‑dipeptide ABC transporter ATPase
RA	1,559,680	G→A	G77G (GGC→GGT)	ddpC ←	D,D‑dipeptide ABC transporter permease
RA	1,565,758	C→T	*461* (TAG→TAA)	dosC ←	diguanylate cyclase, cold‑ and stationary phase‑induced oxygen‑dependent biofilm regulator
RA	1,571,332	G→T	I238I (ATC→ATA)	gadB ←	glutamate decarboxylase B, PLP‑dependent
RA	1,571,902	G→A	D48D (GAC→GAT)	gadB ←	glutamate decarboxylase B, PLP‑dependent
RA	1,571,917	G→A	F43F (TTC→TTT)	gadB ←	glutamate decarboxylase B, PLP‑dependent
RA	1,598,617	C→T	*531* (TAG→TAA)	lsrK ←	autoinducer‑2 (AI‑2) kinase
RA	1,614,789	C→T	intergenic (‑86/‑15)	sad ← / → yneJ	succinate semialdehyde dehydrogenase, NAD(P)+‑dependent/putative DNA‑binding transcriptional regulator
RA	1,618,218	G→A	*397* (TAG→TAA)	ydeA →	arabinose efflux transporter, arabinose‑inducible
RA	1,619,957	G→A	*128* (TAG→TAA)	marA →	multiple antibiotic resistance transcriptional regulator
RA	1,620,207	G→A	*73* (TAG→TAA)	marB →	periplasmic mar operon regulator
RA	1,621,542	G→A	D71N (GAC→AAC)	ydeE →	putative transporter
RA	1,624,357	(T)8→7	coding (141/393 nt)	ydeI ←	hydrogen peroxide resistance OB fold protein, putative periplasmic protein
RA	1,626,825	C→T	V186I (GTT→ATT)	dcp ←	dipeptidyl carboxypeptidase II
RA	1,627,124	T→C	D86G (GAT→GGT)	dcp ←	dipeptidyl carboxypeptidase II
RA	1,627,625	T→C	L37L (TTG→CTG)	ydfG →	NADP‑dependent 3‑hydroxy acid dehydrogenase, malonic semialdehyde reductase
RA	1,630,986	A→G	intergenic (‑73/+16)	ydfI ← / ← ydfJ	putative NAD‑dependent D‑mannonate oxidoreductase/pseudogene, MFS transporter family, interrupted by Qin prophage,Phage or Prophage Related, putative transport protein
RA	1,639,030	C→T	*166* (TAG→TAA)	rzpQ ←	Rz‑like protein, Qin prophage
RA	1,649,041	G→A	*73* (TAG→TAA)	ydfC →	uncharacterized protein, Qin prophage
RA	1,651,537	G→A	pseudogene (693/693 nt)	insD1 →	IS2 transposase TnpB,IS, phage, Tn, Transposon‑related functions, extrachromosomal, transposon related
RA	1,655,057	T→C	T29A (ACG→GCG)	rspA ←	bifunctional D‑altronate/D‑mannonate dehydratase
RA	1,655,347	C→T	*109* (TAG→TAA)	ynfA ←	UPF0060 family inner membrane protein
RA	1,655,360	(C)5→4	coding (314/327 nt)	ynfA ←	UPF0060 family inner membrane protein
RA	1,656,744	G→A	*187* (TAG→TAA)	speG →	spermidine N(1)‑acetyltransferase
RA	1,664,096	T→C	I163T (ATA→ACA)	ynfH →	oxidoreductase, membrane subunit
RA	1,665,120	G→A	*205* (TAG→TAA)	dmsD →	twin‑argninine leader‑binding protein for DmsA and TorA
RA	1,670,581	G→A	G295R (GGA→AGA)	ynfM →	putative arabinose efflux transporter
RA	1,673,314	A→G	L63P (CTG→CCG)	mdtJ ←	multidrug efflux system transporter
RA	1,673,789	T→C	intergenic (‑288/‑124)	mdtJ ← / → tqsA	multidrug efflux system transporter/pheromone AI‑2 transporter
RA	1,676,624	T→C	H427R (CAC→CGC)	pntA ←	pyridine nucleotide transhydrogenase, alpha subunit
RA	1,685,542	(C)6→5	coding (1047/1404 nt)	fumC ←	fumarate hydratase (fumarase C),aerobic Class II
RA	1,691,192	G→A	Q447Q (CAG→CAA)	ydgA →	DUF945 family protein
RA	1,696,452	(A)5→4	intergenic (‑381/+10)	uidA ← / ← uidR	beta‑D‑glucuronidase/transcriptional repressor
RA	1,700,201	(T)5→6	coding (847/1593 nt)	malX →	maltose and glucose‑specific PTS enzyme IIB component and IIC component
RA	1,709,163	T→C	S8P (TCC→CCC)	rsxD →	SoxR iron‑sulfur cluster reduction factor component, putative membrane protein of electron transport complex
RA	1,712,518	(C)6→7	intergenic (+360/‑251)	nth → / → dtpA	DNA glycosylase and apyrimidinic (AP) lyase (endonuclease III)/dipeptide and tripeptide permease A
RA	1,714,326	(T)9→8	intergenic (+55/‑51)	dtpA → / → gstA	dipeptide and tripeptide permease A/glutathionine S‑transferase
RA	1,719,058	G→A	P182L (CCG→CTG)	anmK ←	anhydro‑N‑acetylmuramic acid kinase
RA	1,726,622	G→A	*200* (TAG→TAA)	nemR →	transcriptional repressor for the nemRA‑gloA operon, quinone‑, glyoxal‑, and HOCl‑activated
RA	1,733,703	G→A	*1539* (TAG→TAA)	lhr →	putative ATP‑dependent helicase
RA	1,735,484	T→C	V36A (GTC→GCC)	sodB →	superoxide dismutase, Fe
RA	1,742,575	G→A	intergenic (+14/+26)	cfa → / ← ribC	cyclopropane fatty acyl phospholipid synthase, SAM‑dependent/riboflavin synthase, alpha subunit
RA	1,744,740	C→T	G428G (GGC→GGT)	mdtK →	multidrug efflux system transporter
RA	1,757,006	G→A	A437T (GCT→ACT)	pykF →	pyruvate kinase I
RA	1,757,721	C→T	*335* (TAG→TAA)	ldtE ←	murein L,D‑transpeptidase
MC JC	1,757,753	Δ5 bp	coding (969‑973/1005 nt)	ldtE ←	murein L,D‑transpeptidase
RA	1,759,680	(C)5→6	coding (844/1221 nt)	sufS ←	cysteine desulfurase, stimulated by SufE, selenocysteine lyase, PLP‑dependent
RA	1,761,518	G→A	R92C (CGT→TGT)	sufD ←	component of SufBCD Fe‑S cluster assembly scaffold
RA	1,763,987	Δ1 bp	coding (23/1488 nt)	sufB ←	component of SufBCD Fe‑S cluster assembly scaffold
RA	1,764,018	C→T	*123* (TAG→TAA)	sufA ←	Fe‑S cluster assembly protein
RA	1,769,478	(G)7→8	coding (405/1113 nt)	ydiK →	UPF0118 family inner membrane protein
RA	1,781,964	C→G	G190G (GGC→GGG)	ydiS →	putative oxidoreductase
RA	1,788,278	G→A	*278* (TAG→TAA)	ppsR →	PEP synthase kinase and PEP synthase pyrophosphorylase
RA	1,789,804	G→A	*64* (TAG→TAA)	ydiE →	hemin uptake protein HemP homolog
RA	1,792,267	C→T	*155* (TAG→TAA)	nlpC ←	putative C40 clan peptidase lipoprotein
RA	1,794,172	C→T	*327* (TAG→TAA)	btuC ←	vitamin B12 ABC transporter permease
RA	1,799,883	T→C	K39K (AAA→AAG)	rpmI ←	50S ribosomal subunit protein L35
RA	1,803,567	G→A	pseudogene (50/1476 nt)	arpB →	pseudogene, ankyrin repeats
RA	1,819,569	A→G	G79G (GGT→GGC)	chbA ←	N,N'‑diacetylchitobiose‑specific enzyme IIA component of PTS
RA	1,821,867	(A)8→7	intergenic (‑248/+51)	chbB ← / ← osmE	N,N'‑diacetylchitobiose‑specific enzyme IIB component of PTS/osmotically‑inducible lipoprotein
RA	1,826,546	T→C	E126E (GAA→GAG)	astE ←	succinylglutamate desuccinylase
RA	1,834,111	G→A	*237* (TAG→TAA)	ydjX →	TVP38/TMEM64 family inner membrane protein
RA	1,841,897	G→A	*136* (TAG→TAA)  T80I (ACT→ATT)	nudG → ynjH ←	CTP pyrophosphohydrolase, also hydrolyzes 2‑hydroxy‑dATP, 8‑hydroxy‑dGTP, 5‑hydroxy‑CTP, dCTP and 5‑methyl‑dCTP DUF1496 family protein
RA	1,850,810	(C)5→4	intergenic (+117/‑50)	sppA → / → ansA	protease IV (signal peptide peptidase)/cytoplasmic L‑asparaginase 1
RA	1,862,634	A→G	intergenic (‑205/‑137)	msrB ← / → gapA	methionine sulfoxide reductase B/glyceraldehyde‑3‑phosphate dehydrogenase A
RA	1,863,004	T→C	R78R (CGT→CGC)	gapA →	glyceraldehyde‑3‑phosphate dehydrogenase A
RA	1,869,022	(T)6→5	coding (68/1284 nt)	yeaH →	UPF0229 family protein
RA	1,874,078	C→T	*35* (TAG→TAA)	yoaI ←	uncharacterized protein
RA	1,874,798	G→A	*149* (TAG→TAA)  T260I (ACT→ATT)	yeaL → yeaM ←	UPF0756 family putative inner membrane protein putative DNA‑binding transcriptional regulator
RA	1,875,056	(C)6→5	coding (521/822 nt)	yeaM ←	putative DNA‑binding transcriptional regulator
RA	1,881,463	G→A	A116V (GCG→GTG)	dmlR ←	transcriptional activator of dmlA
RA	1,886,810	G→A	*322* (TAG→TAA)	yeaX →	putative YeaWX dioxygenase beta subunit, reductase component
RA	1,892,402	A→G	S278S (AGT→AGC)	yoaA ←	putative ATP‑dependent helicase, DinG family
RA	1,905,805	G→A	G40S (GGC→AGC)	mntP →	putative Mn(2+) efflux pump, mntR‑regulated
RA	1,910,474	T→C	S67P (TCC→CCC)	yebQ →	putative transporter
RA	1,920,205	(T)7→8	intergenic (+62/‑18)	yebT → / → rsmF	MCE domain protein/16S rRNA m(5)C1407 methyltransferase, SAM‑dependent
RA	1,926,096	G→A	*219* (TAG→TAA)	yobB →	C‑N hydrolase family protein
RA	1,926,782	G→A	*221* (TAG→TAA)  D686D (GAC→GAT)	exoX → ptrB ←	exodeoxyribonuclease 10, DNA exonuclease X protease II
RA	1,939,673	T→C	N174S (AAC→AGC)	lpxM ←	myristoyl‑acyl carrier protein (ACP)‑dependent acyltransferase
RA	1,942,993	G→A	G111E (GGG→GAG)	znuC →	zinc ABC transporter ATPase
RA	1,950,559	(C)5→6	intergenic (‑37/‑273)	aspS ← / → yecD	aspartyl‑tRNA synthetase/isochorismatase family protein
RA	1,952,661	G→A	*132* (TAG→TAA)	yecN →	MAPEG family inner membrane protein
RA	1,964,697	G→A	L118L (CTC→CTT)	flhA ←	putative flagellar export pore protein
MC JC	1,978,503	Δ776 bp		insB1–insA	insB1, insA
RA	1,980,188	C→T	*475* (TAG→TAA)	otsA ←	trehalose‑6‑phosphate synthase
RA	1,998,494	C→T	*329* (TAG→TAA)	dcyD ←	D‑cysteine desulfhydrase, PLP‑dependent
RA	2,012,001	C→T	pseudogene (40/678 nt)	yedN ←	pseudogene, IpaH/YopM family
RA	2,012,700	C→T	*105* (TAG→TAA)	fliE ←	flagellar basal‑body component
RA	2,016,095	G→A	L76L (CTG→CTA)	fliH →	negative regulator of FliI ATPase activity
RA	2,021,501	G→A	*138* (TAG→TAA)	fliN →	flagellar motor switching and energizing component
RA	2,022,606	G→A	*246* (TAG→TAA)	fliP →	flagellar biosynthesis protein
RA	2,022,810	C→T	A65A (GCC→GCT)	fliQ →	flagellar biosynthesis protein
RA	2,022,885	G→A	*90* (TAG→TAA)	fliQ →	flagellar biosynthesis protein
RA	2,029,729	(C)6→5	coding (191/921 nt)	yedA →	amino acid exporter for phenylalanine, threonine
RA	2,034,536	G→A	pseudogene (486/663 nt)	yedS →	pseudogene, outer membrane protein homology, putative outer membrane protein
RA	2,049,336	C→T	P1467S (CCG→TCG)	yeeJ →	putative adhesin
RA	2,051,158	A→G	D2074G (GAC→GGC)	yeeJ →	putative adhesin
RA	2,059,964	C→T	*317* (TAG→TAA)	cbl ←	ssuEADCB/tauABCD operon transcriptional activator
RA	2,068,952	C→T	*302* (TAG→TAA)	insD1 ←	IS2 transposase TnpB
RA	2,084,773	G→A	G251G (GGC→GGT)	yeeE ←	UPF0394 family inner membrane protein
RA	2,090,046	G→A	*17* (TAG→TAA)	hisL →	his operon leader peptide
RA	2,099,237	G→A	A126V (GCG→GTG)	ugd ←	UDP‑glucose 6‑dehydrogenase
RA	2,104,494	C→T	V6I (GTC→ATC)  *197* (TAG→TAA)	wbbK ← wbbJ ←	lipopolysaccharide biosynthesis protein putative lipopolysaccharide biosynthesis O‑acetyl transferase
RA	2,114,502	C→T	*465* (TAG→TAA)	wcaM ←	colanic acid biosynthesis protein
RA	2,115,907	C→T	*407* (TAG→TAA)	wcaL ←	putative glycosyl transferase
RA	2,118,164	G→A	R81C (CGT→TGT)	wcaK ←	colanic acid biosynthesis protein
RA	2,130,853	C→T	S9N (AGC→AAC)  *406* (TAG→TAA)	wcaD ← wcaC ←	putative colanic acid polymerase putative glycosyl transferase
RA	2,131,667	T→C	D135G (GAC→GGC)	wcaC ←	putative glycosyl transferase
RA	2,139,759	C→T	*618* (TAG→TAA)	asmA ←	suppressor of OmpF assembly mutants, putative outer membrane protein assembly factor, inner membrane‑anchored periplasmic protein
RA	2,149,963	G→T	G341G (GGC→GGA)	yegI ←	protein kinase‑related putative non‑specific DNA‑binding protein
RA	2,152,876	G→A	P85S (CCG→TCG)	yegL ←	VMA domain protein
RA	2,161,529	G→A	Q22Q (CAG→CAA)	iceT →	putative citrate/iron‑citrate/zinc‑citrate efflux transporter
RA	2,163,207	A→G	D111G (GAT→GGT)	baeS →	sensory histidine kinase in two‑component regulatory system with BaeR
RA	2,164,998	G→A	*241* (TAG→TAA)	baeR →	response regulator in two‑component regulatory system with BaeS
RA	2,169,693	C→T	pseudogene (475/475 nt)	gatR ←	pseudogene, repressor for gat operon, interrupted by IS3, split galactitol utilization operon repressor, fragment 2, split galactitol utilization operon repressor, interrupted
RA	2,171,398	G→A	*289* (TAG→TAA)	insF1 →	IS3 transposase B
RA	2,173,363	Δ2 bp	intergenic (‑1/+1)	gatC ← / ← gatC	pseudogene, galactitol‑specific enzyme IIC component of PTS,transport, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS,transport, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system galactitol‑specific enzyme IIC
RA	2,179,330	T→C	S170S (AGT→AGC)	yegT →	nucleoside transporter, low affinity
RA	2,182,035	C→T	L314L (CTA→TTA)  *249* (TAG→TAA)	yegV → yegW ←	putative kinase putative DNA‑binding transcriptional regulator
RA	2,182,061	G→A	*322* (TAG→TAA)  L241L (CTA→TTA)	yegV → yegW ←	putative kinase putative DNA‑binding transcriptional regulator
RA	2,189,594	C→T	A439A (GCG→GCA)	yehB ←	putative outer membrane protein
RA	2,200,454	(A)8→7	coding (176/3633 nt)	yehI →	DUF4132 domain‑containing protein
RA	2,203,986	(A)5→6	coding (15/318 nt)	yehK →	uncharacterized protein
RA	2,210,944	G→A	pseudogene (1845/2001 nt)	yehQ →	pseudogene
RA	2,214,339	(C)6→5	coding (306/1686 nt)	yehU ←	inner membrane putative sensory kinase in two‑component system with YehT
RA	2,218,207	C→T	A117A (GCG→GCA)	yehY ←	putative ABC transporter permease
RA	2,220,789	G→A	R401C (CGT→TGT)	bglX ←	beta‑D‑glucoside glucohydrolase, periplasmic
RA	2,225,044	C→T	*196* (TAG→TAA)	yohC ←	Yip1 family inner membrane protein
RA	2,226,509	C→T	*254* (TAG→TAA)	yohF ←	putative oxidoreductase
RA	2,233,597	G→A	*240* (TAG→TAA)	sanA →	DUF218 superfamily vancomycin high temperature exclusion protein
RA	2,240,754	(C)5→6	coding (915/1041 nt)	galS ←	galactose‑ and fucose‑inducible galactose regulon transcriptional isorepressor, mgl operon transcriptional repressor, autorepressor
RA	2,244,245	G→A	A112A (GCG→GCA)	yeiG →	S‑formylglutathione hydrolase
RA	2,263,478	T→C	V6V (GTA→GTG)	fruB ←	fused fructose‑specific PTS enzymes: IIA component/HPr component
RA	2,266,013	T→C	R188R (CGT→CGC)	yeiP →	elongation factor P‑like protein
RA	2,274,166	A→G	K601K (AAA→AAG)	yejA →	microcin C ABC transporter periplasmic binding protein
RA	2,274,178	G→A	*605* (TAG→TAA)	yejA →	microcin C ABC transporter periplasmic binding protein
RA	2,276,298	G→A	*342* (TAG→TAA)	yejE →	microcin C ABC transporter permease
RA	2,276,530	G→A	S77S (TCG→TCA)	yejF →	microcin C ABC transporter ATPase
RA	2,288,561	(C)7→6	pseudogene (354/2525 nt)	yejO ←	pseudogene, autotransporter outer membrane homology,putative transport, Not classified, putative ATP‑binding component of a transport system
RA	2,289,027	G→A	intergenic (‑113/+38)	yejO ← / ← insH1	pseudogene, autotransporter outer membrane homology,putative transport, Not classified, putative ATP‑binding component of a transport system/IS5 transposase and trans‑activator
RA	2,291,973	T→C	G146G (GGA→GGG)	ccmH ←	heme lyase, CcmH subunit
RA	2,316,160	G→A	*891* (TAG→TAA)	rcsD →	phosphotransfer intermediate protein in two‑component regulatory system with RcsBC
RA	2,317,027	C→T	*950* (TAG→TAA)	rcsC ←	hybrid sensory kinase in two‑component regulatory system with RcsB and YojN
RA	2,318,019	G→A	R620C (CGT→TGT)	rcsC ←	hybrid sensory kinase in two‑component regulatory system with RcsB and YojN
RA	2,334,336	C→T	pseudogene (67/4605 nt) *208* (TAG→TAA)	yfaS ← yfaT ←	pseudogene, bacterial alpha2‑macroglobulin YfaS variant family, putative membrane protein DUF1175 family protein, putative host defense protein
RA	2,350,162	A→G	L284L (TTG→CTG)	glpQ ←	periplasmic glycerophosphodiester phosphodiesterase
RA	2,358,163	G→A	A228V (GCG→GTG)	rhmA ←	2‑keto‑3‑deoxy‑L‑rhamnonate aldolase
RA	2,370,019	T→C	*661R (TGA→CGA)  M1T (ATG→ACG) †	arnA → arnD →	fused UDP‑L‑Ara4N formyltransferase/UDP‑GlcA C‑4'‑decarboxylase undecaprenyl phosphate‑alpha‑L‑ara4FN deformylase
RA	2,379,348	C→T	*432* (TAG→TAA)	menF ←	isochorismate synthase 2
RA	2,414,699	T→C	intergenic (+27/‑48)	ackA → / → pta	acetate kinase A and propionate kinase 2/phosphate acetyltransferase
RA	2,416,763	2 bp→TC	coding (2017‑2018/2145 nt)	pta →	phosphate acetyltransferase
RA	2,438,548	T→C	V200A (GTG→GCG)	flk →	putative flagella assembly protein
RA	2,449,228	C→T	*274* (TAG→TAA)	yfcO ←	DUF2544 family putative outer membrane protein
RA	2,453,265	C→T	pseudogene (1737/2646 nt)	yfcU ←	pseudogene, FimD fimbrial export usher family,putative membrane, Not classified, putative outer membrane protein
RA	2,462,889	(C)9→8	intergenic (+243/‑123)	fadL → / → yfdF	long‑chain fatty acid outer membrane transporter/uncharacterized protein
RA	2,468,106	T→C	A84A (GCT→GCC)	gtrA →	CPS‑53 (KpLE1) prophage, bactoprenol‑linked glucose translocase/flippase
RA	2,471,105	G→A	pseudogene (291/291 nt) P138L (CCT→CTT)	tfaS → yfdK ←	pseudogene, CPS‑53 (KpLE1) prophage, tail fiber assembly protein fragment,Phage or Prophage Related CPS‑53 (KpLE1) prophage, conserved protein
RA	2,478,092	A→G	V82V (GTA→GTG)	dsdX →	D‑serine transporter
RA	2,484,897	(C)6→7	coding (524/3594 nt)	evgS →	hybrid sensory histidine kinase in two‑component regulatory system with EvgA
RA	2,494,950	T→C	Y85H (TAT→CAT)	ypdI →	putative lipoprotein involved in colanic acid biosynthesis
RA	2,494,973	G→A	*92* (TAG→TAA)	ypdI →	putative lipoprotein involved in colanic acid biosynthesis
RA	2,495,050	C→T	*81* (TAG→TAA)	yfdY ←	DUF2545 family putative inner membrane protein
RA	2,504,391	T→C	E32G (GAA→GGA)	fryA ←	putative PTS enzyme: Hpr, enzyme I and IIA components
RA	2,510,111	G→A	G161D (GGC→GAC)	yfeO →	putative ion channel protein
RA	2,510,886	G→A	*419* (TAG→TAA)	yfeO →	putative ion channel protein
RA	2,511,468	C→T	*413* (TAG→TAA)	mntH ←	manganese/divalent cation transporter
RA	2,521,593	C→T	*295* (TAG→TAA)	xapR ←	transcriptional activator of xapAB
RA	2,521,852	T→C	D209G (GAT→GGT)	xapR ←	transcriptional activator of xapAB
MC JC	2,525,917	Δ9 bp	intergenic (+26/+5)	yfeN → / ← yfeR	putative outer membrane protein/transcriptional regulator of yefH
RA	2,525,930	C→T	*309* (TAG→TAA)	yfeR ←	transcriptional regulator of yefH
RA	2,534,031	T→C	intergenic (+10/‑35)	ptsH → / → ptsI	phosphohistidinoprotein‑hexose phosphotransferase component of PTS system (Hpr)/PEP‑protein phosphotransferase of PTS system (enzyme I)
RA	2,552,094	G→A	I15I (ATC→ATT)	ypeA ←	GNAT family putative N‑acetyltransferase
RA	2,574,135	G→A	D57D (GAC→GAT)	eutT ←	cobalamin adenosyltransferase involved in ethanolamine utilization
RA	2,589,535	C→T	I647I (ATC→ATT)	acrD →	aminoglycoside/multidrug efflux system
RA	2,591,603	G→A	*119* (TAG→TAA)	yffB →	putative ArsC family reductase
RA	2,595,227	T→C	Q211Q (CAA→CAG)	tmcA ←	elongator methionine tRNA (ac4C34) acetyltransferase
RA	2,600,609	(C)5→6	coding (132/471 nt)	bcp →	peroxiredoxin, thiol peroxidase, thioredoxin‑dependent
MC JC	2,614,614	Δ3 bp	coding (681‑683/849 nt)	focB →	putative formate transporter
RA	2,618,075	C→T	*234* (TAG→TAA)	hda ←	ATPase regulatory factor involved in DnaA inactivation
RA	2,621,307	A→G	E37E (GAA→GAG)	purM →	phosphoribosylaminoimidazole synthetase
RA	2,629,481	G→A	*64* (TAG→TAA)	yfgG →	uncharacterized protein
RA	2,637,295	C→T	R21H (CGT→CAT)	der ←	GTPase, multicopy suppressor of ftsJ
RA	2,645,013	C→T	*771* (TAG→TAA)	pbpC ←	penicillin‑insensitive murein repair transglycosylase, inactive transpeptidase domain protein
RA	2,655,767	T→C	T198A (ACT→GCT)	pepB ←	aminopeptidase B
RA	2,673,768	G→A	*141* (TAG→TAA)	yphA →	DoxX family inner membrane protein
RA	2,682,157	(C)7→8	coding (589/3282 nt)	yphG ←	DUF4380 domain‑containing TPR repeat protein
RA	2,684,971	G→A	G179G (GGC→GGT)	glyA ←	serine hydroxymethyltransferase
RA	2,685,561	T→C	intergenic (‑54/‑274)	glyA ← / → hmp	serine hydroxymethyltransferase/fused nitric oxide dioxygenase/dihydropteridine reductase 2
RA	2,685,910	G→A	A26T (GCC→ACC)	hmp →	fused nitric oxide dioxygenase/dihydropteridine reductase 2
RA	2,697,915	C→T	*212* (TAG→TAA)	pgpC ←	phosphatidylglycerophosphatase C, membrane bound
RA	2,713,568	T→C	W225R (TGG→CGG)	srmB →	ATP‑dependent RNA helicase
RA	2,721,193	C→T	A414V (GCA→GTA)	pka →	protein lysine acetyltransferase
RA	2,723,065	G→A	A113A (GCG→GCA)	pssA →	phosphatidylserine synthase, CDP‑diacylglycerol‑serine O‑phosphatidyltransferase
RA	2,724,448	C→T	H107H (CAC→CAT)  *433* (TAG→TAA)	yfiM → kgtP ←	putative lipoprotein alpha‑ketoglutarate transporter
RA	2,737,495	G→A	*114* (TAG→TAA)	raiA →	cold shock protein associated with 30S ribosomal subunit
RA	2,742,962	G→A	D194N (GAT→AAT)	yfiN →	putative membrane‑anchored diguanylate cyclase
RA	2,765,829	(C)5→4	intergenic (‑53/‑89)	yfjM ← / → rnlA	CP4‑57 prophage, uncharacterized protein/CP4‑57 prophage, RNase LS
RA	2,767,445	(C)7→8	intergenic (+90/‑265)	rnlB → / → yfjP	CP4‑57 prophage, uncharacterized protein/CP4‑57 prophage, 50S ribosome‑binding GTPase family protein
RA	2,769,486	G→A	*274* (TAG→TAA)	yfjQ →	CP4‑57 prophage, uncharacterized protein
RA	2,769,648	(C)6→5	intergenic (+162/‑55)	yfjQ → / → yfjR	CP4‑57 prophage, uncharacterized protein/CP4‑57 prophage, putative DNA‑binding transcriptional regulator
RA	2,770,404	G→A	*234* (TAG→TAA)	yfjR →	CP4‑57 prophage, putative DNA‑binding transcriptional regulator
RA	2,781,132	T→C	D532G (GAC→GGC)	ypjA ←	adhesin‑like autotransporter
RA	2,782,393	(C)5→4	coding (334/4581 nt)	ypjA ←	adhesin‑like autotransporter
RA	2,784,529	C→T	pseudogene (483/1374 nt)	ypjC ←	pseudogene
RA	2,786,729	G→A	pseudogene (333/2253 nt)	ygaQ →	uncharacterized protein, putative enzyme
RA	2,786,746	Δ1 bp	pseudogene (350/2253 nt)	ygaQ →	uncharacterized protein, putative enzyme
RA	2,787,434	G→A	pseudogene (1038/2253 nt)	ygaQ →	uncharacterized protein, putative enzyme
RA	2,788,238	G→A	pseudogene (1842/2253 nt)	ygaQ →	uncharacterized protein, putative enzyme
RA	2,794,015	G→A	*427* (TAG→TAA)	gabT →	4‑aminobutyrate aminotransferase, PLP‑dependent
RA	2,796,146	C→T	A158V (GCG→GTG)	csiR →	transcriptional repressor of csiD
RA	2,796,337	C→T	*150* (TAG→TAA)	ygaU ←	uncharacterized protein
RA	2,796,916	T→C	Y38C (TAT→TGT)	yqaE ←	cyaR sRNA‑regulated protein
RA	2,800,475	G→A	*110* (TAG→TAA)	ygaM →	putative membrane‑anchored DUF883 family ribosome‑binding protein
RA	2,814,218	C→T	*172* (TAG→TAA)	luxS ←	S‑ribosylhomocysteine lyase
RA	2,824,491	C→T	*362* (TAG→TAA)	mltB ←	membrane‑bound lytic murein transglycosylase B
RA	2,824,496	Δ1 bp	coding (1081/1086 nt)	mltB ←	membrane‑bound lytic murein transglycosylase B
RA	2,827,351	G→A	*320* (TAG→TAA)	srlE →	glucitol/sorbitol‑specific enzyme IIB component of PTS
RA	2,835,045	G→A	*378* (TAG→TAA)	norW →	NADH:flavorubredoxin oxidoreductase
RA	2,839,384	T→A	intergenic (‑120/‑140)	ascG ← / → ascF	asc operon transcriptional repressor, prpBC operon repressor/cellobiose/arbutin/salicin‑specific PTS enzymes, IIB and IC components
RA	2,842,414	G→A	*475* (TAG→TAA)	ascB →	cryptic 6‑phospho‑beta‑glucosidase
RA	2,842,573	C→T	*157* (TAG→TAA)	hycI ←	protease involved in processing C‑terminal end of HycE
RA	2,851,873	G→A	*291* (TAG→TAA)  G4S (GGC→AGC)	hypB → hypC →	GTP hydrolase involved in nickel liganding into hydrogenases hydrogenase maturation protein
RA	2,856,453	C→T	*118* (TAG→TAA)	ygbA ←	uncharacterized protein
RA	2,859,538	C→T	L816L (CTG→TTG)	mutS →	methyl‑directed mismatch repair protein
RA	2,860,416	G→A	*219* (TAG→TAA)	pphB →	serine/threonine‑specific protein phosphatase 2
RA	2,860,426	Δ1 bp	intergenic (+10/+41)	pphB → / ← ygbI	serine/threonine‑specific protein phosphatase 2/DeoR family putative transcriptional regulator
RA	2,876,944	G→A	A122T (GCC→ACC)	iap →	aminopeptidase in alkaline phosphatase isozyme conversion
RA	2,893,928	G→A	*424* (TAG→TAA)  A4T (GCC→ACC)	ygcN → ygcO →	putative oxidoreductase putative 4Fe‑4S cluster‑containing protein
MC JC	2,893,961	Δ3 bp	coding (43‑45/261 nt)	ygcO →	putative 4Fe‑4S cluster‑containing protein
RA	2,902,543	G→A	G216G (GGG→GGA)	ygcE →	putative kinase
RA	2,905,532	T→C	intergenic (‑114/‑25)	queE ← / → yqcG	7‑carboxy‑7‑deazaguanine synthase, queosine biosynthesis/membrane stress resistance protein
RA	2,910,756	C→T	*112* (TAG→TAA)	mazF ←	mRNA interferase toxin, antitoxin is MazE
RA	2,911,417	C→T	*745* (TAG→TAA)	relA ←	(p)ppGpp synthetase I/GTP pyrophosphokinase
RA	2,913,699	C→T	*434* (TAG→TAA)	rlmD ←	23S rRNA m(5)U1939 methyltransferase, SAM‑dependent
RA	2,915,105	C→T	P17S (CCG→TCG)	barA →	hybrid sensory histidine kinase, in two‑component regulatory system with UvrY
RA	2,935,917	G→A	G112S (GGC→AGC)	fucI →	L‑fucose isomerase
RA	2,936,931	T→C	F450L (TTC→CTC)	fucI →	L‑fucose isomerase
RA	2,937,802	A→G	D112G (GAC→GGC)	fucK →	L‑fuculokinase
RA	2,962,441	C→T	*108* (TAG→TAA)	ppdC ←	putative prepilin peptidase‑dependent protein
RA	2,966,188	C→T	*749* (TAG→TAA)	ptsP ←	PEP‑protein phosphotransferase enzyme I, GAF domain containing protein
RA	2,967,135	G→A	R434C (CGT→TGT)	ptsP ←	PEP‑protein phosphotransferase enzyme I, GAF domain containing protein
RA	2,970,351	G→A	*230* (TAG→TAA)	mutH →	methyl‑directed mismatch repair protein
RA	2,979,943	C→T	A308V (GCT→GTT)  *231* (TAG→TAA)	lysR → ygeA ←	transcriptional activator of lysA, autorepressor Asp/Glu_racemase family protein
RA	2,983,288	C→T	*279* (TAG→TAA)	kduI ←	hexuronate isomerase
RA	2,984,411	C→T	*394* (TAG→TAA)	yqeF ←	short chain acyltransferase
RA	2,993,856	G→A	*73* (TAG→TAA)	ygeI →	uncharacterized protein
RA	2,994,415	G→A	pseudogene (34/60 nt)	pbl →	pseudogene, peptidoglycan‑binding enzyme family
RA	2,995,314	C→T	pseudogene (447/447 nt)	ygeN ←	pseudogene, orgB family, part of T3SS PAI ETT2 remnant
RA	2,996,372	C→T	*302* (TAG→TAA)	insD1 ←	IS2 transposase TnpB
RA	2,997,689	C→T	intergenic (‑89/+3)	insC1 ← / ← ygeQ	IS2 repressor TnpA/pseudogene, glycosyl hydrolase family 15, part of T3SS PAI ETT2 remnant
RA	3,001,304	(G)7→8	coding (960/2259 nt)	xdhA →	xanthine dehydrogenase, molybdenum binding subunit
RA	3,012,553	Δ1 bp	intergenic (+160/+61)	yqeA → / ← yqeB	putative amino acid kinase/XdhC‑CoxI family protein with NAD(P)‑binding Rossman fold
RA	3,014,259	Δ1 bp	intergenic (‑20/+28)	yqeB ← / ← yqeC	XdhC‑CoxI family protein with NAD(P)‑binding Rossman fold/putative selenium‑dependent hydroxylase accessory protein
RA	3,014,287	C→T	*257* (TAG→TAA)	yqeC ←	putative selenium‑dependent hydroxylase accessory protein
RA	3,015,738	G→A	*193* (TAG→TAA)	mocA →	CTP:molybdopterin cytidylyltransferase
RA	3,032,032	G→A	S222S (TCG→TCA)	uacT →	uric acid permease
RA	3,036,373	C→T	*578* (TAG→TAA)	recJ ←	ssDNA exonuclease, 5' ‑‑> 3'‑specific
RA	3,056,273	G→A	P11P (CCG→CCA)	fau →	5‑formyltetrahydrofolate cyclo‑ligase family protein
RA	3,059,293	T→C	G11G (GGA→GGG)	rpiA ←	ribose 5‑phosphate isomerase, constitutive
RA	3,061,202	A→G	N118S (AAC→AGC)	scpA →	methylmalonyl‑CoA mutase
RA	3,068,173	C→T	*212* (TAG→TAA)	argO ←	arginine transporter
RA	3,073,474	T→C	D73G (GAC→GGC)	epd ←	D‑erythrose 4‑phosphate dehydrogenase
RA	3,082,038	T→C	D42D (GAT→GAC)	loiP →	Phe‑Phe periplasmic metalloprotease, OM lipoprotein, low salt‑inducible, Era‑binding heat shock protein
RA	3,083,620	G→A	R60C (CGT→TGT)	speB ←	agmatinase
RA	3,085,461	A→G	S151P (TCC→CCC)	speA ←	biosynthetic arginine decarboxylase, PLP‑binding
RA	3,094,234	T→C	T283A (ACA→GCA)	yggR ←	putative PilT family AAA+ ATPase
RA	3,096,673	G→A	*97* (TAG→TAA)	yggU →	UPF0235 family protein
RA	3,101,039	(C)7→8	coding (585/720 nt)	yggN ←	DUF2884 family putative periplasmic protein
RA	3,104,065	G→A	*351* (TAG→TAA)	mutY →	adenine DNA glycosylase
RA	3,129,036	G→A	*255* (TAG→TAA)	glcC →	glycolate‑inducible glc operon transcriptional repressor, autorepressor
RA	3,131,341	C→T	*356* (TAG→TAA)	yghQ ←	putative inner membrane polysaccharide flippase
RA	3,134,811	Δ1 bp	coding (681/693 nt)	yghT →	putative ATP‑binding protein
RA	3,134,823	G→A	*231* (TAG→TAA)	yghT →	putative ATP‑binding protein
RA	3,140,294	T→C	S9G (AGC→GGC)	hybF ←	protein involved with the maturation of hydrogenases 1 and 2
RA	3,162,308	G→A	S121L (TCG→TTG)	ftsP ←	septal ring component that protects the divisome from stress, multicopy suppressor of ftsI(Ts)
RA	3,171,879	C→T	*111* (TAG→TAA)	ygiZ ←	inner membrane protein
RA	3,176,721	G→A	T38I (ACC→ATC)	cpdA ←	3',5' cAMP phosphodiesterase
RA	3,176,858	C→T	*141* (TAG→TAA)	yqiB ←	DUF1249 protein YqiB
RA	3,178,015	G→A	intergenic (‑105/‑100)	nudF ← / → tolC	ADP‑ribose pyrophosphatase/transport channel
RA	3,183,006	G→A	G153S (GGT→AGT)	zupT →	zinc transporter
RA	3,187,415	G→A	*302* (TAG→TAA)	insD1 →	IS2 transposase TnpB
RA	3,187,588	G→A	pseudogene (162/2439 nt)	yqiG →	pseudogene, fimbrial export usher family,putative membrane, Not classified, putative membrane protein
RA	3,191,696	G→A	*355* (TAG→TAA)	yqiI →	fimbrial protein
RA	3,199,429	T→C	A71A (GCA→GCG)	glnE ←	fused deadenylyltransferase/adenylyltransferase for glutamine synthetase
RA	3,205,324	C→T	*311* (TAG→TAA)	ttdR ←	transcriptional activator of ttdABT
RA	3,218,365	C→T	E238K (GAG→AAG)	aer ←	fused signal transducer for aerotaxis sensory component/methyl accepting chemotaxis component
RA	3,220,190	G→A	A233T (GCT→ACT)	patA →	putrescine:2‑oxoglutaric acid aminotransferase, PLP‑dependent
RA	3,238,562	(T)7→6	intergenic (+265/‑18)	ygjR → / → alx	putative NAD(P)‑dependent dehydrogenase/putative membrane‑bound redox modulator
RA	3,240,587	A→G	Y215C (TAC→TGC)	sstT →	sodium:serine/threonine symporter
RA	3,240,984	(G)7→9	coding (1041/1245 nt)	sstT →	sodium:serine/threonine symporter
RA	3,248,939	T→C	intergenic (+117/‑30)	mzrA → / → yqjC	modulator of EnvZ/OmpR regulon/DUF1090 family putative periplasmic protein
RA	3,255,020	G→A	*234* (TAG→TAA)	yhaK →	redox‑sensitive bicupin
RA	3,257,675	G→A	G112G (GGC→GGT)	yhaO ←	putative transporter
RA	3,266,127	C→T	*313* (TAG→TAA)	tdcA ←	tdc operon transcriptional activator
RA	3,269,012	A→G	S200G (AGT→GGT)	yhaC →	pentapetide repeats‑related protein
RA	3,269,602	G→A	*396* (TAG→TAA)	yhaC →	pentapetide repeats‑related protein
RA	3,271,932	T→C	T274A (ACG→GCG)	garR ←	tartronate semialdehyde reductase
RA	3,277,726	C→T	F130F (TTC→TTT)	yhaV →	toxin of the SohB(PrlF)‑YhaV toxin‑antitoxin system
RA	3,277,867	C→T	V267I (GTC→ATC)	agaR ←	transcriptional repressor of the aga regulon
RA	3,296,984	G→A	*192* (TAG→TAA)	yraP →	outer membrane lipoprotein
RA	3,298,035	T→C	E35G (GAA→GGA)	yraQ ←	putative inner membrane permease
RA	3,299,438	A→G	T155T (ACA→ACG)	yhbO →	stress‑resistance protein
RA	3,299,999	G→A	A12T (GCC→ACC)	yhbQ →	GIY‑YIG nuclease superfamily protein
RA	3,301,599	G→A	G39S (GGC→AGC)	yhbU →	U32 peptidase family protein
RA	3,303,529	C→T	H28Y (CAC→TAC)	yhbW →	putative luciferase‑like monooxygenase
RA	3,304,455	G→A	*336* (TAG→TAA)	yhbW →	putative luciferase‑like monooxygenase
RA	3,308,040	C→T	*295* (TAG→TAA)	nlpI ←	lipoprotein involved in osmotic sensitivity and filamentation
RA	3,308,868	G→A	C19C (TGC→TGT)	nlpI ←	lipoprotein involved in osmotic sensitivity and filamentation
RA	3,309,006	(C)6→5	intergenic (‑82/+27)	nlpI ← / ← pnp	lipoprotein involved in osmotic sensitivity and filamentation/polynucleotide phosphorylase/polyadenylase
RA	3,309,007	G→A	intergenic (‑83/+26)	nlpI ← / ← pnp	lipoprotein involved in osmotic sensitivity and filamentation/polynucleotide phosphorylase/polyadenylase
RA	3,320,333	T→C	E427E (GAA→GAG)	yhbX ←	putative EptAB family phosphoethanolamine transferase, inner membrane protein
RA	3,330,357	+T	coding (1395/1434 nt)	dacB →	D‑alanyl‑D‑alanine carboxypeptidase
RA	3,330,396	G→A	*478* (TAG→TAA)	dacB →	D‑alanyl‑D‑alanine carboxypeptidase
RA	3,340,588	T→C	L105S (TTA→TCA)	yrbG →	putative calcium/sodium:proton antiporter
RA	3,347,069	G→A	*164* (TAG→TAA)	ptsN →	sugar‑specific enzyme IIA component of PTS
RA	3,353,121	C→T	*310* (TAG→TAA)	yhcC ←	putative Fe‑S oxidoreductase, Radical SAM superfamily protein
RA	3,360,769	G→A	intergenic (+153/‑407)	gltD → / → gltF	glutamate synthase, 4Fe‑4S protein, small subunit/periplasmic protein
RA	3,365,664	G→A	intergenic (+113/+38)	yhcE → / ← insH1	pseudogene fragment, interrupted by IS5/IS5 transposase and trans‑activator
RA	3,366,953	G→A	G10R (GGA→AGA)	yhcF →	putative transcriptional regulator
RA	3,372,254	G→A	G107G (GGC→GGT)	nanT ←	sialic acid transporter
RA	3,385,857	C→T	*91* (TAG→TAA)	yhcO ←	putative barnase inhibitor
RA	3,398,875	C→T	M1M (GTG→ATG) † *368* (TAG→TAA)	mreD ← mreC ←	cell wall structural complex MreBCD transmembrane component MreD cell wall structural complex MreBCD transmembrane component MreC
RA	3,400,773	A→G	R105R (CGT→CGC)	mreB ←	cell wall structural complex MreBCD, actin‑like component MreB
RA	3,410,406	T→C	S43P (TCT→CCT)	dusB →	tRNA‑dihydrouridine synthase B
RA	3,418,548	T→C	A53A (GCT→GCC)	yhdV →	putative outer membrane protein
RA	3,432,994	(C)6→7	coding (567/1125 nt)	smf ←	DNA recombination‑mediator A family protein
RA	3,434,577	G→A	A122T (GCA→ACA)	fmt →	10‑formyltetrahydrofolate:L‑methionyl‑tRNA(fMet) N‑formyltransferase
RA	3,439,141	C→T	*123* (TAG→TAA)	yhdN ←	DUF1992 family protein
RA	3,440,950	G→A	T27I (ACC→ATC)	rpoA ←	RNA polymerase, alpha subunit
RA	3,457,616	G→A	A414T (GCC→ACC)	gspD →	general secretory pathway component, cryptic
RA	3,466,313	A→G	L138P (CTT→CCT)	bfr ←	bacterioferritin, iron storage and detoxification protein
RA	3,478,592	C→T	*67* (TAG→TAA)	yheV ←	DUF2387 family putative metal‑binding protein
RA	3,478,802	C→T	*602* (TAG→TAA)	kefB ←	potassium:proton antiporter
RA	3,482,967	T→C	L560P (CTG→CCG)	yheS →	ABC‑F family protein predicted regulatory ATPase
RA	3,503,952	G→A	*262* (TAG→TAA)	frlD →	fructoselysine 6‑kinase
RA	3,507,942	A→G	Y217H (TAC→CAC)	php ←	phosphotriesterase homology protein
RA	3,508,454	Δ1 bp	coding (137/879 nt)	php ←	phosphotriesterase homology protein
RA	3,515,726	T→C	Y63C (TAT→TGT)	dam ←	DNA adenine methyltransferase
RA	3,516,104	T→C	K401K (AAA→AAG)	damX ←	cell division protein that binds to the septal ring
RA	3,531,605	T→C	T279A (ACA→GCA)	yhgE ←	DUF4153 family putative inner membrane protein
RA	3,534,656	C→T	G405R (GGG→AGG)	envZ ←	sensory histidine kinase in two‑component regulatory system with OmpR
RA	3,544,074	C→T	*257* (TAG→TAA)	bioH ←	pimeloyl‑ACP methyl ester carboxylesterase
RA	3,545,565	G→A	*228* (TAG→TAA)	gntX →	DNA catabolic protein
RA	3,547,986	C→T	*695* (TAG→TAA)	malQ ←	4‑alpha‑glucanotransferase (amylomaltase)
RA	3,556,033	A→G	Y273H (TAC→CAC)	rtcA ←	RNA 3'‑terminal phosphate cyclase
RA	3,560,455	+G	intergenic (‑2/+1)	glpR ← / ← glpR	pseudogene, DNA‑binding transcriptional repressor,regulator, Energy metabolism, carbon: Anaerobic respiration, repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor,regulator, Energy metabolism, carbon: Anaerobic respiration, repressor of the glp operon
RA	3,566,600	C→T	*478* (TAG→TAA)	glgA ←	glycogen synthase
RA	3,567,251	C→T	L261L (TTG→TTA)	glgA ←	glycogen synthase
RA	3,583,454	G→A	intergenic (+36/‑29)	yrhA → / → insA	pseudogene, interrupted by IS1E/IS1 repressor TnpA
RA	3,587,370	C→T	T143I (ACT→ATT)  *248* (TAG→TAA)	yhhA → ugpQ ←	DUF2756 family protein glycerophosphodiester phosphodiesterase, cytosolic
RA	3,587,389	G→A	P242L (CCG→CTG)	ugpQ ←	glycerophosphodiester phosphodiesterase, cytosolic
RA	3,589,820	T→C	S70G (AGC→GGC)	ugpE ←	sn‑glycerol‑3‑phosphate ABC transporter permease
RA	3,598,557	A→G	*368Q (TAA→CAA)	livJ ←	branched‑chain amino acid ABC transporter periplasmic binding protein
RA	3,614,092	T→C	I142I (ATT→ATC)	nikA →	nickel/heme ABC transporter periplasmic binding protein
RA	3,643,899	G→A	G428G (GGC→GGT)	prlC ←	oligopeptidase A
RA	3,652,144	G→A	intergenic (+113/+38)	yhiS → / ← insH1	pseudogene/IS5 transposase and trans‑activator
RA	3,658,893	G→A	*176* (TAG→TAA)	gadE →	gad regulon transcriptional activator
RA	3,664,363	(G)6→7	coding (256/729 nt)	gadW ←	transcriptional activator of gadA and gadBC, repressor of gadX
RA	3,664,986	C→T	*275* (TAG→TAA)	gadX ←	acid resistance regulon transcriptional activator, autoactivator
RA	3,683,630	C→T	*663* (TAG→TAA)	yhjK ←	cyclic‑di‑GMP phosphodiesterase
RA	3,694,840	G→A	H133Y (CAT→TAT)	bcsA ←	cellulose synthase, catalytic subunit
RA	3,695,997	C→T	*63* (TAG→TAA)	yhjR ←	DUF2629 family protein
RA	3,709,561	(C)6→7	coding (915/1692 nt)	eptB ←	KDO phosphoethanolamine transferase, Ca(2+)‑inducible
RA	3,719,768	G→A	*97* (TAG→TAA)	yiaG →	HTH_CROC1 family putative transcriptional regulator
RA	3,731,980	G→A	G284S (GGT→AGT)	xylF →	D‑xylose transporter subunit
RA	3,732,319	G→A	G40E (GGG→GAG)	xylG →	D‑xylose ABC transporter dual domain ATPase
RA	3,736,157	G→A	*393* (TAG→TAA)	xylR →	xylose divergent operon transcriptional activator
RA	3,736,160	+A	intergenic (+3/+193)	xylR → / ← bax	xylose divergent operon transcriptional activator/putative glucosaminidase
RA	3,742,599	Δ1 bp	intergenic (‑67/‑134)	yiaJ ← / → yiaK	transcriptional repressor for the yiaKLMNO‑lyxK‑sgbHUE operon/2,3‑diketo‑L‑gulonate reductase, NADH‑dependent
RA	3,750,092	G→A	*287* (TAG→TAA)  E3K (GAG→AAG)	sgbU → sgbE →	putative L‑xylulose 5‑phosphate 3‑epimerase L‑ribulose‑5‑phosphate 4‑epimerase
RA	3,761,850	C→T	A36T (GCG→ACG)	yibF ←	glutathione S‑transferase homolog
RA	3,766,316	G→A	*1378* (TAG→TAA)	rhsA →	Rhs protein with putative toxin 55 domain, putative polysaccharide synthesis/export protein, putative neighboring cell growth inhibitor
RA	3,767,179	G→A	*281* (TAG→TAA)	yibA →	putative immunity protein for polymorphic toxin RhsA, HEAT‑domain protein, lethality reduction protein
RA	3,773,602	T→C	V441A (GTT→GCT)	mtlA →	mannitol‑specific PTS enzyme: IIA, IIB and IIC components
RA	3,781,017	G→A	*397* (TAG→TAA)	lldD →	L‑lactate dehydrogenase, FMN‑linked
RA	3,781,688	G→A	*158* (TAG→TAA)	trmL →	tRNA Leu mC34,mU34 2'‑O‑methyltransferase, SAM‑dependent
RA	3,783,086	G→A	G192G (GGC→GGT)	gpsA ←	glycerol‑3‑phosphate dehydrogenase (NAD+)
RA	3,789,047	C→T	A316V (GCT→GTT)  *345* (TAG→TAA)	yibQ → waaH ←	putative polysaccharide deacetylase LPS(HepIII)‑glucuronic acid glycosyltransferase
RA	3,789,352	G→A	R244C (CGC→TGC)	waaH ←	LPS(HepIII)‑glucuronic acid glycosyltransferase
RA	3,789,683	C→T	W133* (TGG→TGA)	waaH ←	LPS(HepIII)‑glucuronic acid glycosyltransferase
RA	3,789,913	C→T	A57T (GCA→ACA)	waaH ←	LPS(HepIII)‑glucuronic acid glycosyltransferase
RA	3,792,826	C→T	*286* (TAG→TAA)	yibB ←	YibB family protein, function unknown
RA	3,804,410	C→G	R236P (CGT→CCT)	waaS ←	lipopolysaccharide rhamnose:KdoIII transferase, lipopolysaccharide core biosynthesis protein
RA	3,810,304	G→A	*160* (TAG→TAA)	coaD →	pantetheine‑phosphate adenylyltransferase
RA	3,815,811	C→T	intergenic (‑43/+23)	pyrE ← / ← rph	orotate phosphoribosyltransferase/ribonuclease PH (defective),enzyme, Degradation of RNA, RNase PH
RA	3,815,863	C→T	pseudogene (19/48 nt)	rph ←	ribonuclease PH (defective),enzyme, Degradation of RNA, RNase PH
RA	3,818,584	G→A	*275* (TAG→TAA)	dinD →	DNA damage‑inducible protein
RA	3,819,488	C→T	H205H (CAC→CAT)  *561* (TAG→TAA)	yicG → ligB ←	UPF0126 family inner membrane protein DNA ligase, NAD(+)‑dependent
RA	3,838,137	G→A	*395* (TAG→TAA)	setC →	putative arabinose efflux transporter
RA	3,842,455	C→T	*445* (TAG→TAA)	adeQ ←	adenine permease, high affinity, adenine:H+ symporter
RA	3,852,890	C→T	*33* (TAG→TAA)	ivbL ←	ilvB operon leader peptide
RA	3,855,960	C→T	S4N (AGC→AAC)  *116* (TAG→TAA)	yidG ← yidH ←	inner membrane protein DUF202 family inner membrane protein
RA	3,862,497	C→T	pseudogene (1107/1617 nt)	glvC ←	pseudogene, arbutin specific enzyme IIC component of PTS,enzyme, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system, arbutin‑like IIB component, PTS system, arbutin‑like IIC component
RA	3,862,518	Δ1 bp	pseudogene (1086/1617 nt)	glvC ←	pseudogene, arbutin specific enzyme IIC component of PTS,enzyme, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system, arbutin‑like IIB component, PTS system, arbutin‑like IIC component
JC	3,862,524	Δ3 bp	pseudogene (1078‑1080/1617 nt)	glvC ←	pseudogene, arbutin specific enzyme IIC component of PTS,enzyme, Transport of small molecules: Carbohydrates, organic acids, alcohols, PTS system, arbutin‑like IIB component, PTS system, arbutin‑like IIC component
RA	3,870,441	G→A	*355* (TAG→TAA)  G430G (GGC→GGT)	cbrA → dgoT ←	colicin M resistance protein, FAD‑binding protein, putative oxidoreductase D‑galactonate transporter
RA	3,892,455	G→A	A281T (GCG→ACG)	mdtL →	multidrug efflux system protein
RA	3,897,050	+G	coding (277/666 nt)	yieH →	phosphoenolpyruvate and 6‑phosphogluconate phosphatase
RA	3,897,439	G→A	*222* (TAG→TAA)	yieH →	phosphoenolpyruvate and 6‑phosphogluconate phosphatase
RA	3,898,609	G→A	*196* (TAG→TAA)	cbrC →	UPF0167 family protein
RA	3,908,514	A→G	intergenic (‑148/+35)	pstB ← / ← pstA	phosphate ABC transporter ATPase/phosphate ABC transporter permease
RA	3,920,950	C→T	*80* (TAG→TAA)	atpE ←	F0 sector of membrane‑bound ATP synthase, subunit c
RA	3,921,515	C→T	T179T (ACG→ACA)	atpB ←	F0 sector of membrane‑bound ATP synthase, subunit a
RA	3,923,070	G→A	A204V (GCA→GTA)	rsmG ←	16S rRNA m(7)G527 methyltransferase, SAM‑dependent, glucose‑inhibited cell‑division protein
RA	3,937,168	G→A	*297* (TAG→TAA)	rbsB →	D‑ribose ABC transporter periplasmic binding protein, ribose chemotaxis receptor
RA	3,939,219	G→A	*331* (TAG→TAA)  S465F (TCT→TTT)	rbsR → hsrA ←	transcriptional repressor of ribose metabolism putative multidrug or homocysteine efflux system
RA	3,948,805	(G)6→7	coding (1165/1521 nt)	yifB ←	magnesium chelatase family protein and putative transcriptional regulator
RA	3,950,420	G→A	*33* (TAG→TAA)	ilvL →	ilvG operon leader peptide
RA	3,956,875	G→A	*515* (TAG→TAA)	ilvA →	l‑threonine dehydratase, biosynthetic, also known as threonine deaminase
RA	3,963,829	C→T	R134H (CGC→CAC)	gpp ←	guanosine pentaphosphatase/exopolyphosphatase
RA	3,965,088	C→T	W181* (TGG→TGA)	rhlB ←	ATP‑dependent RNA helicase
RA	3,970,015	T→C	W329R (TGG→CGG)	wzzE →	Entobacterial Common Antigen (ECA) polysaccharide chain length modulation protein
RA	3,970,032	(G)6→8	coding (1002/1047 nt)	wzzE →	Entobacterial Common Antigen (ECA) polysaccharide chain length modulation protein
RA	3,970,077	G→A	*349* (TAG→TAA)	wzzE →	Entobacterial Common Antigen (ECA) polysaccharide chain length modulation protein
RA	3,976,605	T→C	F110L (TTT→CTT)	wzxE →	O‑antigen translocase
RA	3,980,957	(G)6→7	coding (71/1386 nt)	yifK →	putative APC family amino acid transporter
RA	3,984,193	G→A	*412* (TAG→TAA)	aslB →	putative AslA‑specific sulfatase‑maturating enzyme
RA	3,986,686	C→T	*399* (TAG→TAA)	hemY ←	putative protoheme IX synthesis protein
RA	3,992,054	C→T	P301L (CCA→CTA)	cyaA →	adenylate cyclase
RA	4,002,813	C→T	*127* (TAG→TAA)	yigG ←	PRK11371 family inner membrane protein
RA	4,007,693	G→A	*610* (TAG→TAA)	recQ →	ATP‑dependent DNA helicase
RA	4,018,760	G→A	*476* (TAG→TAA)	rmuC →	DNA recombination protein
RA	4,024,336	G→A	*261* (TAG→TAA)  L162L (CTC→CTT)	tatD → rfaH ←	quality control of Tat‑exported FeS proteins, Mg‑dependent cytoplasmic DNase transcription antitermination protein
RA	4,054,439	A→G	T280T (ACT→ACC)	glnG ←	fused DNA‑binding response regulator in two‑component regulatory system with GlnL: response regulator/sigma54 interaction protein
RA	4,061,157	G→A	*237* (TAG→TAA)	yihL →	putative DNA‑binding transcriptional regulator
RA	4,075,454	G→A	*262* (TAG→TAA)	yihW →	putative transcriptional regulator for sulphoquinovose utilization
RA	4,077,469	G→A	L7L (TTG→TTA)	yiiD →	GNAT family putative N‑acetyltransferase
RA	4,078,438	G→A	*330* (TAG→TAA)	yiiD →	GNAT family putative N‑acetyltransferase
RA	4,106,320	G→A	*167* (TAG→TAA)	cpxP →	inhibitor of the cpx response, periplasmic adaptor protein
RA	4,112,787	C→T	intergenic (+32/‑180)	yiiR → / → yiiS	DUF805 family putative inner membrane protein/UPF0381 family protein
RA	4,117,123	G→A	R34C (CGC→TGC)	glpK ←	glycerol kinase
RA	4,137,229	A→G	S143S (AGT→AGC)	yijF ←	DUF1287 family protein
RA	4,147,479	G→A	*114* (TAG→TAA)  T280I (ACT→ATT)	frwD → yijO ←	putative enzyme IIB component of PTS AraC family putative transcriptional activator
RA	4,148,681	C→T	G529S (GGC→AGC)	eptC ←	LPS heptose I phosphoethanolamine transferase
RA	4,204,645	G→A	*442* (TAG→TAA)  N429N (AAC→AAT)	zraR → purD ←	fused DNA‑binding response regulator in two‑component regulatory system with ZraS: response regulator/sigma54 interaction protein phosphoribosylglycinamide synthetase phosphoribosylamine‑glycine ligase
RA	4,213,680	C→T	*148* (TAG→TAA)	yjaB ←	GNAT‑family putative N‑acetyltransferase, acetyl coenzyme A‑binding protein
RA	4,218,815	A→G	T74A (ACG→GCG)	aceK →	isocitrate dehydrogenase kinase/phosphatase
RA	4,232,752	G→A	A161V (GCG→GTG)	lysC ←	lysine‑sensitive aspartokinase 3
RA	4,268,487	(T)7→8	intergenic (+180/+322)	tyrB → / ← yjbS	tyrosine aminotransferase, tyrosine‑repressible, PLP‑dependent/uncharacterized protein
RA	4,268,809	C→T	*68* (TAG→TAA)	yjbS ←	uncharacterized protein
RA	4,279,849	A→G	intergenic (+21/‑131)	ghxP → / → yjcE	guanine/hypoxanthine permease, high affinity, guanine/hypoxanthine:H+ symporter/putative cation/proton antiporter
RA	4,296,381	+GC	intergenic (+587/+55)	gltP → / ← yjcO	glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein
RA	4,297,668	C→T	D567N (GAC→AAC)	fdhF ←	formate dehydrogenase‑H, selenopolypeptide subunit
RA	4,302,240	A→G	I280T (ATC→ACC)	mdtO ←	membrane translocase (MDR) of MdtNOP efflux pump, PET family
RA	4,317,409	C→T	G163S (GGC→AGC)	phnL ←	ribophosphonate triphosphate synthase subunit, putative ABC transporter‑related ATPase
RA	4,324,876	A→G	L97P (CTG→CCG)	phnC ←	phosphonate ABC transporter ATPase
RA	4,325,152	A→G	I5T (ATC→ACC)	phnC ←	phosphonate ABC transporter ATPase
RA	4,331,634	C→T	A378V (GCG→GTG)	proP →	proline/glycine betaine transporter
RA	4,336,405	A→G	S209S (AGT→AGC)	adiC ←	arginine:agmatine antiporter
RA	4,346,086	A→G	I414T (ATC→ACC)	fumB ←	anaerobic class I fumarate hydratase (fumarase B)
RA	4,352,880	G→A	*99* (TAG→TAA)	ghoS →	antitoxin of GhoTS toxin‑antitoxin pair, endonuclease for ghoT mRNA
RA	4,353,081	G→A	*58* (TAG→TAA)	ghoT →	toxin of GhoTS toxin‑antitoxin pair, membrane‑lytic protein, stimulator of persister cell formation
RA	4,377,189	C→T	H105H (CAC→CAT)  *178* (TAG→TAA)	sugE → blc ←	multidrug efflux system protein outer membrane lipoprotein cell division and growth lipocalin
RA	4,386,872	C→T	A833A (GCG→GCA)	mscM ←	mechanosensitive channel protein, miniconductance
RA	4,389,934	A→G	Y143H (TAC→CAC)	psd ←	phosphatidylserine decarboxylase
RA	4,395,058	C→T	G331G (GGC→GGT)	nnr →	bifunctional NAD(P)H‑hydrate repair enzyme, C‑terminal domain ADP‑dependent (S)‑NAD(P)H‑hydrate dehydratase and N‑terminal domain NAD(P)H‑hydrate epimerase
RA	4,422,793	C→T	A203V (GCC→GTC)	ulaD →	3‑keto‑L‑gulonate 6‑phosphate decarboxylase
RA	4,424,386	G→A	*229* (TAG→TAA)	ulaF →	L‑ribulose 5‑phosphate 4‑epimerase
RA	4,424,516	C→T	*92* (TAG→TAA)	yjfY ←	YhcN family protein, periplasmic
RA	4,424,543	Δ1 bp	coding (249/276 nt)	yjfY ←	YhcN family protein, periplasmic
RA	4,425,834	G→A	*105* (TAG→TAA)	priB →	primosomal protein N
RA	4,428,079	C→T	pseudogene (386/402 nt) *213* (TAG→TAA)	ytfA → ytfB ←	pseudogene, related to transcriptional regulators OapA family protein
RA	4,433,164	C→T	*287* (TAG→TAA)	qorB ←	NAD(P)H:quinone oxidoreductase
RA	4,441,538	C→T	*213* (TAG→TAA)	msrA ←	methionine sulfoxide reductase A
RA	4,442,007	T→C	E57G (GAG→GGG)	msrA ←	methionine sulfoxide reductase A
RA	4,447,869	Δ1 bp	coding (3758/3780 nt)	tamB →	translocation and assembly module for autotransporter export, inner membrane subunit
RA	4,447,891	G→A	*1260* (TAG→TAA)	tamB →	translocation and assembly module for autotransporter export, inner membrane subunit
RA	4,474,138	(A)6→7	coding (15/594 nt)	bdcR →	transcriptional repressor for divergent bdcA
RA	4,474,391	G→A	G90S (GGC→AGC)	bdcR →	transcriptional repressor for divergent bdcA
RA	4,475,562	(G)6→7	coding (126/1815 nt)	yjgL →	SopA‑central‑domain‑like hexapeptide repeat protein
MC JC	4,490,116	Δ11 bp	intergenic (‑53/+15)	yjgR ← / ← idnR	DUF853 family protein with NTPase fold/transcriptional repressor, 5‑gluconate‑binding
RA	4,490,141	C→T	*333* (TAG→TAA)	idnR ←	transcriptional repressor, 5‑gluconate‑binding
RA	4,490,375	C→T	A255A (GCG→GCA)	idnR ←	transcriptional repressor, 5‑gluconate‑binding
RA	4,499,500	G→A	*302* (TAG→TAA)	insD1 →	IS2 transposase TnpB
RA	4,499,640	C→T	pseudogene (895/942 nt)	yjgX ←	pseudogene fragment
RA	4,500,043	C→T	pseudogene (492/942 nt)	yjgX ←	pseudogene fragment
RA	4,500,060	C→T	pseudogene (475/942 nt)	yjgX ←	pseudogene fragment
RA	4,504,006	G→A	intergenic (‑575/‑52)	insG ← / → yjhB	IS4 transposase/putative MFS transporter, membrane protein
RA	4,507,463	G→A	intergenic (+12/+3)	insO → / ← insI1	pseudogene, IS911 transposase B,IS, phage, Tn, Transposon‑related functions, extrachromosomal, transposon related/IS30 transposase
RA	4,510,188	A→G	intergenic (+55/+502)	yjhV → / ← fecE	pseudogene, KpLE2 phage‑like element/ferric citrate ABC transporter ATPase
RA	4,510,690	C→T	*256* (TAG→TAA)	fecE ←	ferric citrate ABC transporter ATPase
RA	4,511,146	C→T	W104* (TGG→TGA)	fecE ←	ferric citrate ABC transporter ATPase
RA	4,515,284	C→T	G465D (GGC→GAC)	fecA ←	TonB‑dependent outer membrane ferric citrate transporter and signal transducer, ferric citrate extracelluar receptor, FecR‑interacting protein
RA	4,519,014	G→A	pseudogene (294/504 nt)	insB1 →	IS1 transposase B,IS, phage, Tn, Transposon‑related functions, extrachromosomal, transposon related
RA	4,535,441	C→T	pseudogene (439/1029 nt)	yjhR →	pseudogene, helicase family, putative frameshift suppressor
RA	4,538,785	C→T	*239* (TAG→TAA)	nanC ←	N‑acetylnuraminic acid outer membrane channel protein
RA	4,541,559	G→A	*201* (TAG→TAA)	fimB →	tyrosine recombinase/inversion of on/off regulator of fimA
JC	4,543,180	(TCCCTCAGTTCTACAGCGGCTCTG)1→2	coding (66/549 nt)	fimA →	major type 1 subunit fimbrin (pilin)
RA	4,549,037	T→C	V77A (GTC→GCC)	fimH →	minor component of type 1 fimbriae
RA	4,565,464	C→A	L129F (TTG→TTT)	yjiM ←	putative 2‑hydroxyglutaryl‑CoA dehydratase
RA	4,565,966	C→T	*427* (TAG→TAA)	yjiN ←	zinc‑type alcohol dehydrogenase‑like protein
RA	4,569,309	G→A	pseudogene (312/921 nt)	yjiP →	pseudogene, transposase_31 family protein
RA	4,577,958	C→T	M1M (GTG→ATG) † *460* (TAG→TAA)	mcrC ← mcrB ←	5‑methylcytosine‑specific restriction enzyme McrBC, subunit McrC 5‑methylcytosine‑specific restriction enzyme McrBC, subunit McrB
RA	4,581,621	G→A	A476A (GCC→GCT)	hsdM ←	DNA methyltransferase M
RA	4,599,234	C→T	G70S (GGT→AGT)	opgB ←	OPG periplasmic biosynthetic phosphoglycerol transferases I (membrane‑bound) and II (soluble)
RA	4,600,589	G→A	S129S (TCC→TCT)	dnaC ←	DNA biosynthesis protein
RA	4,604,202	G→A	*242* (TAG→TAA)  E15K (GAA→AAA)	yjjQ → bglJ →	putative transcriptional regulator bgl operon transcriptional activator
RA	4,606,215	(G)8→7	noncoding (72/87 nt)	leuP ←	tRNA‑Leu
RA	4,606,239	A→G	noncoding (48/87 nt)	leuP ←	tRNA‑Leu
RA	4,609,336	(C)7→8	intergenic (+13/‑78)	yjjG → / → prfC	dUMP phosphatase/peptide chain release factor RF‑3
RA	4,612,289	G→A	*54* (TAG→TAA)	ytjA →	uncharacterized protein
RA	4,614,260	G→A	*260* (TAG→TAA)	yjjV →	putative DNase
MC JC	4,619,478	Δ9 bp	coding (1250‑1258/1323 nt)	deoA →	thymidine phosphorylase
RA	4,619,913	A→G	E104G (GAA→GGA)	deoB →	phosphopentomutase
RA	4,623,101	C→T	*339* (TAG→TAA)	lplA ←	lipoate‑protein ligase A
RA	4,631,593	G→A	W287* (TGG→TGA)	slt →	lytic murein transglycosylase, soluble
RA	4,634,581	A→G	Y244H (TAC→CAC)	rob ←	right oriC‑binding transcriptional activator, AraC family
RA	4,638,120	G→A	*475* (TAG→TAA)	creC →	sensory histidine kinase in two‑component regulatory system with CreB or PhoB

Unassigned missing coverage evidence
			seq id	start	end	size	←reads	reads→	gene	description
*	*	÷	NC_000913	66626	66746	121	21 [19]	[19] 20	araD/araA	L‑ribulose‑5‑phosphate 4‑epimerase/L‑arabinose isomerase
*	*	÷	NC_000913	225825–226021	226880–226606	586–1056	20 [18]	[18] 20	rrlH	23S ribosomal RNA of rrnH operon
*	*	÷	NC_000913	583489	583618	130	22 [18]	[15] 22	tfaX/appY	pseudogene, DLP12 prophage,Phage or Prophage Related/global transcriptional activator, DLP12 prophage
*	*	÷	NC_000913	789973	789980	8	25 [16]	[0] 64	[galK]	[galK]
*	*	÷	NC_000913	807293	810371	3079	21 [17]	[19] 23	ybhB–[bioB]	ybhB, bioA, [bioB]
*	*	÷	NC_000913	1427848	1428215–1428086	239–368	20 [17]	[19] 22	insH1	IS5 transposase and trans‑activator
*	*	÷	NC_000913	1432743–1433198	1434028–1433668	471–1286	20 [18]	[16] 22	[tfaR]–[ynaE]	[tfaR], pinR, [ynaE]
*	*	÷	NC_000913	1958272	1958350	79	21 [19]	[17] 20	torY/cutC	TMAO reductase III (TorYZ), cytochrome c‑type subunit/copper homeostasis protein
*	*	÷	NC_000913	2033822	2033975	154	20 [15]	[14] 20	rseX/yedS	sRNA antisense regulator of ompA and ompC translation, Hfq‑dependent/pseudogene, outer membrane protein homology, putative outer membrane protein
*	*	÷	NC_000913	2469329	2469518	190	21 [16]	[17] 24	gtrS	serotype‑specific glucosyl transferase, CPS‑53 (KpLE1) prophage
*	*	÷	NC_000913	2699942	2700036	95	22 [17]	[16] 20	yfhL/shoB	putative 4Fe‑4S cluster‑containing protein/toxic membrane protein
*	*	÷	NC_000913	3423748–3424234	3424559–3424242	9–812	21 [18]	[16] 23	[rrfD]–[rrlD]	[rrfD], [rrlD]
*	*	÷	NC_000913	3762331–3764072	3765243–3764076	5–2913	20 [18]	[19] 20	rhsA	Rhs protein with putative toxin 55 domain, putative polysaccharide synthesis/export protein, putative neighboring cell growth inhibitor
*	*	÷	NC_000913	3769655	3769917	263	21 [15]	[17] 22	[yibV]–yibV	[yibV], yibV
*	*	÷	NC_000913	3793676	3793756	81	23 [19]	[16] 26	[yibB]	[yibB]
*	*	÷	NC_000913	4037911–4038688	4039313–4038730	43–1403	22 [19]	[19] 21	rrlA	23S ribosomal RNA of rrnA operon
*	*	÷	NC_000913	4410063	4410121	59	20 [19]	[17] 21	rlmB/yjfI	23S rRNA mG2251 2'‑O‑ribose methyltransferase, SAM‑dependent/DUF2170 family protein

Unassigned new junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	NC_000913	= 788831	0 (0.000)	64 (0.960)	51/200	0.1	100%	coding (7/1041 nt) coding (1149/1149 nt)	galM galK	aldose 1‑epimerase, type‑1 mutarotase, galactose mutarotase galactokinase
	?	NC_000913	789981 =	0 (0.000)					intergenic (‑2/+2)	galK/galT	galactokinase/galactose‑1‑phosphate uridylyltransferase
*	?	NC_000913	788831 =	0 (0.000)	107 (1.570)	57/204	0.1	97.3%	coding (7/1041 nt) coding (1149/1149 nt)	galM galK	aldose 1‑epimerase, type‑1 mutarotase, galactose mutarotase galactokinase
	?	NC_000913	3742633 =	6 (0.090)					intergenic (‑101/‑100)	yiaJ/yiaK	transcriptional repressor for the yiaKLMNO‑lyxK‑sgbHUE operon/2,3‑diketo‑L‑gulonate reductase, NADH‑dependent
*	?	NC_000913	1207790 =	20 (0.290)	53 (0.920)	39/172	0.3	72.2%	coding (290/630 nt)	stfP	e14 prophage, uncharacterized protein
	?	NC_000913	1209619 =	24 (0.420)					pseudogene (1/501 nt)	stfE	pseudogene, e14 prophage, side tail fiber protein fragment family,Phage or Prophage Related
*	?	NC_000913	= 1207805	20 (0.290)	31 (0.540)	21/172	1.6	60.3%	coding (305/630 nt)	stfP	e14 prophage, uncharacterized protein
	?	NC_000913	= 1209602	24 (0.420)					pseudogene (18/501 nt)	stfE	pseudogene, e14 prophage, side tail fiber protein fragment family,Phage or Prophage Related
*	?	NC_000913	1286708 =	80 (1.170)	36 (0.670)	21/162	1.4	50.2%	intergenic (+182/+358)	narI/rttR	nitrate reductase 1, gamma (cytochrome b(NR)) subunit/rtT sRNA, processed from tyrT transcript
	?	NC_000913	= 1287241	8 (0.150)					intergenic (‑5/+3)	rttR/tyrV	rtT sRNA, processed from tyrT transcript/tRNA‑Tyr
*	?	NC_000913	= 1287084	6 (0.090)	34 (0.620)	17/164	2.0	54.5%	noncoding (153/171 nt)	rttR	rtT sRNA, processed from tyrT transcript
	?	NC_000913	1287557 =	52 (0.950)					noncoding (66/85 nt)	tyrT	tRNA‑Tyr
*	?	NC_000913	= 1299498	0 (0.000)	27 (0.410)	19/196	2.3	100%	intergenic (+253/‑1684)	ychE/oppA	UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein
	?	NC_000913	1300698 =	0 (0.000)					intergenic (+1453/‑484)	ychE/oppA	UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein