mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | ||||||
|---|---|---|---|---|---|---|
| evidence | position | mutation | freq | annotation | gene | description |
| MC JC | 257,908 | Δ776 bp | 100% | insB9–[crl] | insB9, insA9, [crl] | |
| MC JC | 1,397,381 | Δ13,756 bp | 100% | [ynaJ]–[ttcA] | 16 genes [ynaJ], uspE, fnr, ogt, abgT, abgB, abgA, abgR, mcaS, smrA, dgcM, zntB, fnrS, ynaL, dbpA, [ttcA] |
|
| MC JC | 1,978,503 | Δ776 bp | 100% | insB‑5–insA‑5 | insB‑5, insA‑5 | |
| RA | 2,173,361 | Δ2 bp | 100% | pseudogene (917‑918/1358 nt) | gatC ← | galactitol‑specific PTS enzyme IIC component |
| RA | 2,867,169 | A→T | 40.1% | I128N (ATC→AAC) | rpoS ← | RNA polymerase, sigma S (sigma 38) factor |
| RA | 3,560,455:1 | +G | 100% | pseudogene (151/758 nt) | glpR ← | DNA‑binding transcriptional repressor GlpR |
| RA | 4,296,060 | C→T | 34.7% | intergenic (+266/+376) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| RA | 4,296,380:1 | +CG | 100% | intergenic (+586/+56) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| JC JC | 4,542,020 | IS5 (–) +4 bp | 12.8% | intergenic (+461/‑14) | fimB → / → fimE | regulator for fimA/regulator for fimA |
| JC | 4,542,367 | (TTTCTCGCCGCGGGAGTCGGC)1→2 | 17.0% | coding (331/597 nt) | fimE → | regulator for fimA |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 3423696–3424234 | 3424607–3424238 | 5–912 | 96 [92] | [90] 95 | [rrfD]–[rrlD] | [rrfD],[rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 1207790 = | 73 (0.490) | 55 (0.450) | 42/144 | NT | 45.2% | coding (290/630 nt) | ycfK | e14 prophage; protein StfP |
| ? | NC_000913 | 1209619 = | 74 (0.610) | pseudogene (37/537 nt) | stfE | e14 prophage; putative side tail fiber protein fragment | |||||
| * | ? | NC_000913 | = 1207805 | 75 (0.500) | 42 (0.340) | 32/144 | NT | 38.3% | coding (305/630 nt) | ycfK | e14 prophage; protein StfP |
| ? | NC_000913 | = 1209602 | 74 (0.610) | pseudogene (54/537 nt) | stfE | e14 prophage; putative side tail fiber protein fragment | |||||
| * | ? | NC_000913 | = 1299498 | 0 (0.000) | 141 (0.990) | 90/168 | NT | 100% | intergenic (+253/‑33) | ychE/insH21 | putative inner membrane protein/IS5 transposase and trans‑activator |
| ? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+151/‑484) | insH21/oppA | IS5 transposase and trans‑activator/oligopeptide ABC transporter periplasmic binding protein | |||||
| * | ? | NC_000913 | 3186096 = | NA (NA) | 13 (0.090) | 11/176 | NT | 6.9% | noncoding (1/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | 4542114 = | 165 (1.170) | coding (78/597 nt) | fimE | regulator for fimA | |||||
| * | ? | NC_000913 | 4542682 = | 113 (0.750) | 6 (0.040) | 6/174 | NT | 5.4% | intergenic (+49/‑433) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit |
| ? | NC_000913 | 4542995 = | 98 (0.660) | intergenic (+362/‑120) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit | |||||
| * | ? | NC_000913 | 4542682 = | 113 (0.750) | 73 (0.540) | 56/158 | NT | 43.9% | intergenic (+49/‑433) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit |
| ? | NC_000913 | 4542996 = | 85 (0.630) | intergenic (+363/‑119) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit | |||||
| * | ? | NC_000913 | = 4542690 | 107 (0.710) | 99 (0.740) | 62/158 | NT | 52.3% | intergenic (+57/‑425) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit |
| ? | NC_000913 | = 4542986 | 85 (0.630) | intergenic (+353/‑129) | fimE/fimA | regulator for fimA/type 1 fimbriae major subunit | |||||