![]() |
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| RA | 29,274 | A→G | intergenic (+79/‑377) | dapB → / → carA | 4‑hydroxy‑tetrahydrodipicolinate reductase/carbamoyl phosphate synthetase subunit alpha |
| MC JC | 257,908 | Δ776 bp | insB9–[crl] | insB9, insA9, [crl] | |
| RA | 889,923 | A→G | intergenic (‑104/‑166) | ybjL ← / → ybjM | putative transport protein YbjL/putative inner membrane protein |
| RA | 1,196,220 | C→T | H366H (CAC→CAT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,232 | C→T | T370T (ACC→ACT) | icd → | isocitrate dehydrogenase |
| RA | 1,196,245 | T→C | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| RA | 1,196,247 | A→G | L375M (TTA→CTG) | icd → | isocitrate dehydrogenase |
| MC JC | 1,291,137 | Δ9 bp | coding (896‑904/1014 nt) | rssB → | regulator of RpoS |
| RA | 1,577,693 | C→T | L550L (CTG→CTA) | yddA ← | ABC transporter family protein YddA |
| RA | 1,870,532 | A→G | T50A (ACA→GCA) | cdgI → | putative c‑di‑GMP binding protein CdgI |
| JC JC | 1,879,829 | Δ1 bp :: IS186 (–) +6 bp :: Δ1 bp | coding (115‑120/360 nt) | yeaR ← | DUF1971 domain‑containing protein YeaR |
| MC JC | 1,978,503 | Δ776 bp | insB‑5–insA‑5 | insB‑5, insA‑5 | |
| RA | 2,173,363 | Δ2 bp | pseudogene (915‑916/1358 nt) | gatC ← | galactitol‑specific PTS enzyme IIC component |
| RA | 2,270,659 | T→G | intergenic (+114/‑67) | mepS → / → pdeN | peptidoglycan DD‑endopeptidase/peptidoglycan LD‑carboxypeptidase/putative c‑di‑GMP phosphodiesterase PdeN |
| RA | 2,655,086 | A→G | L425L (TTA→CTA) | pepB ← | aminopeptidase B |
| RA | 3,354,487 | C→T | intergenic (‑437/‑238) | yhcC ← / → gltB | radical SAM family oxidoreductase YhcC/glutamate synthase subunit GltB |
| RA | 3,560,455 | +G | pseudogene (151/758 nt) | glpR ← | DNA‑binding transcriptional repressor GlpR |
| JC | 3,562,595 | (GAAGATATCGATACCGGCAAAAAAT)1→2 | coding (583/1506 nt) | glpD → | aerobic glycerol 3‑phosphate dehydrogenase |
| RA | 3,626,286 | G→A | P173L (CCC→CTC) | yhhJ ← | ABC transporter family protein YhhJ |
| RA | 3,815,883 | +C | coding (667/687 nt) | rph ← | truncated RNase PH |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 1196264 | 1211433 | 15170 | 26 [23] | [22] 31 | [icd]–[icdC] | [icd],ymfD,ymfE,lit,intE,xisE,ymfH,ymfI,ymfJ,ymfK,ymfT,ymfL,ymfM,oweE,ymfN,aaaE,ymfR,beeE,jayE,ymfQ,ycfK,tfaP,tfaE,stfE,pinE,mcrA,[icdC] |
| * | * | ÷ | NC_000913 | 3423749–3424233 | 3424535–3424240 | 8–787 | 25 [24] | [23] 25 | [rrfD]–[rrlD] | [rrfD],[rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 1299498 | 0 (0.000) | 86 (0.990) | 58/266 | 0.2 | 100% | intergenic (+253/‑33) | ychE/insH21 | putative inner membrane protein/IS5 transposase and trans‑activator |
| ? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+151/‑484) | insH21/oppA | IS5 transposase and trans‑activator/oligopeptide ABC transporter periplasmic binding protein | |||||
| * | ? | NC_000913 | 3363001 = | 101 (1.120) | 151 (1.690) | 76/272 | 0.0 | 74.9% | coding (195/2382 nt) | yhcD | putative fimbrial usher protein YhcD |
| ? | NC_000913 | 3766087 = | 1 (0.010) | coding (3905/4134 nt) | rhsA | rhs element protein RhsA | |||||
| * | ? | NC_000913 | = 3653230 | NA (NA) | 80 (0.890) | 55/274 | 0.3 | 96.4% | noncoding (1/1195 nt) | IS5 | repeat region |
| ? | NC_000913 | = 3766089 | 3 (0.030) | coding (3907/4134 nt) | rhsA | rhs element protein RhsA | |||||
| * | ? | NC_000913 | = 3765592 | NA (NA) | 91 (1.020) | 59/272 | 0.2 | 100% | coding (3410/4134 nt) | rhsA | rhs element protein RhsA |
| ? | NC_000913 | 3765639 = | 0 (0.000) | coding (3457/4134 nt) | rhsA | rhs element protein RhsA | |||||