mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Marginal read alignment evidence (highest frequency 20 of 176 shown, sorted by frequency from high to low) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | ref | new | freq | score (cons/poly) | reads | annotation | genes | product | ||
| * | AssemblyC74_contig_15 | 33,109 | 0 | T | G | 73.3% | 2164.5 / inf | 1046 | K211T (AAA→ACA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein |
| * | AssemblyC74_contig_1 | 117 | 0 | C | T | 73.2% | 971.4 / inf | 1006 | intergenic (–/‑475) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| * | AssemblyC74_contig_15 | 33,161 | 0 | T | G | 72.4% | 2380.2 / inf | 1188 | T194P (ACC→CCC) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein |
| * | AssemblyC74_contig_43 | 1,217 | 0 | A | G | 72.4% | 1888.5 / inf | 1056 | intergenic (‑2/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| * | AssemblyC74_contig_12 | 59,225 | 0 | A | G | 72.3% | 1009.6 / inf | 662 | V38A (GTG→GCG) ‡ | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| * | AssemblyC74_contig_12 | 59,224 | 0 | C | T | 72.2% | 932.1 / inf | 662 | V38V (GTG→GTA) ‡ | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| * | AssemblyC74_contig_43 | 1,046 | 0 | T | G | 71.2% | 1970.5 / inf | 1109 | E57A (GAA→GCA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| * | AssemblyC74_contig_1 | 65 | 0 | T | C | 70.6% | 275.6 / inf | 565 | intergenic (–/‑527) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| * | AssemblyC74_contig_1 | 66 | 0 | A | G | 70.5% | 278.2 / inf | 566 | intergenic (–/‑526) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| * | AssemblyC74_contig_12 | 59,239 | 0 | G | A | 69.1% | 867.4 / inf | 690 | G33G (GGC→GGT) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| * | AssemblyC74_contig_30 | 153 | 0 | A | G | 69.1% | 821.2 / inf | 728 | T51T (ACA→ACG) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein |
| * | AssemblyC74_contig_30 | 166 | 0 | T | C | 67.2% | 908.7 / inf | 910 | L56L (TTA→CTA) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein |
| * | AssemblyC74_contig_47 | 485 | 0 | G | A | 65.9% | 943.2 / inf | 848 | D162N (GAT→AAT) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| * | AssemblyC74_contig_15 | 33,663 | 0 | C | A | 65.3% | 568.7 / inf | 528 | T26T (ACG→ACT) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Mobile element protein |
| * | AssemblyC74_contig_30 | 210 | 0 | T | C | 64.5% | 722.1 / inf | 845 | R70R (CGT→CGC) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Mobile element protein |
| * | AssemblyC74_contig_1 | 198 | 0 | A | G | 63.4% | 575.6 / inf | 662 | intergenic (–/‑394) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| * | AssemblyC74_contig_44 | 666 | 0 | T | C | 62.9% | 1750.1 / inf | 1670 | K157K (AAA→AAG) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| * | AssemblyC74_contig_44 | 638 | 0 | G | A | 62.1% | 1509.6 / inf | 1768 | L167L (CTA→TTA) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| * | AssemblyC74_contig_44 | 678 | 0 | G | A | 61.7% | 1273.5 / inf | 1537 | I153I (ATC→ATT) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| * | AssemblyC74_contig_44 | 635 | 0 | A | T | 61.5% | 1665.2 / inf | 1787 | S168T (TCC→ACC) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein |
| Marginal new junction evidence (lowest skew 10 of 38 shown) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | AssemblyC74_contig_47 | = 622 | NA (NA) | 11 (0.030) +GATACGTCAAATGTTACGAA |
7/218 | 0.0 | 5.6% | noncoding (21/29 nt) | direct | CRISPR repeat with sequence agtgtagatgtaagtaattggaatacgtc |
| ? | AssemblyC74_contig_61 | = 87 | 218 (0.360) | coding (336/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_47 | 421 = | NA (NA) | 7 (0.020) +GCATTCATAGA |
7/236 | 0.1 | 1.5% | coding (420/879 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein |
| ? | AssemblyC74_contig_61 | 243 = | 494 (0.810) | coding (180/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_61 | 1 = | 0 (0.000) | 5 (0.010) | 4/240 | 0.2 | 4.8% | intergenic (–/+2) | –/rasttk_feature_annotation_tool=elepa@bvbrc | –/hypothetical protein |
| ? | AssemblyC74_contig_61 | = 78 | 199 (0.350) | coding (345/420 nt) | rasttk_feature_annotation_tool=elepa@bvbrc | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_13 | 1 = | 0 (0.000) | 128 (0.590) | 31/258 | 3.4 | 70.7% | coding (1/234 nt) | rasttk_feature_annotation_tool=annotate_proteins_si milarity | Transcriptional antiterminator of lichenan operon, BglG family |
| ? | AssemblyC74_contig_34 | 2046 = | 106 (0.480) | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– | |||||
| * | ? | AssemblyC74_contig_16 | = 35103 | 0 (0.000) | 95 (0.130) | 39/258 | 3.5 | 100% | intergenic (+149/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_45 | 1 = | 0 (0.000) | coding (906/906 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Integrase, catalytic region | |||||
| * | ? | AssemblyC74_contig_2 | 1 = | 0 (0.000) | 130 (0.560) +A |
29/256 | 3.7 | 71.2% | intergenic (–/+1) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/hypothetical protein |
| ? | AssemblyC74_contig_34 | 2046 = | 106 (0.480) | intergenic (‑223/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | PaaD‑like protein (DUF59) involved in Fe‑S cluster assembly/– | |||||
| * | ? | AssemblyC74_contig_1 | = 261 | 301 (1.040) | 181 (0.620) | 40/256 | 4.2 | 54.8% | intergenic (–/‑331) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Two‑component transcriptional response regulator, OmpR family |
| ? | AssemblyC74_contig_7 | 2 = | 0 (0.000) | intergenic (–/+269) | –/rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | –/Lysyl‑tRNA synthetase (class II) (EC 6.1.1.6) | |||||
| * | ? | AssemblyC74_contig_16 | 35042 = | NA (NA) | 99 (0.470) +G |
30/256 | 4.5 | 100% | intergenic (+88/–) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2/– | hypothetical protein/– |
| ? | AssemblyC74_contig_4 | = 189292 | 0 (0.000) | intergenic (+1/–) | rasttk_feature_annotation_tool=elepa@bvbrc/– | hypothetical protein/– | |||||
| * | ? | AssemblyC74_contig_12 | 59051 = | 88 (0.310) | 100 (0.350) | 39/256 | 4.6 | 49.2% | coding (287/672 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | Putative peptidoglycan bound protein (LPXTG motif) Lmo2178 homolog |
| ? | AssemblyC74_contig_18 | 27024 = | 119 (0.420) | coding (2182/2232 nt) | rasttk_feature_annotation_tool=annotate_proteins_km er_v2 | hypothetical protein | |||||
| * | ? | AssemblyC74_contig_13 | = 46006 | 230 (1.070) | 113 (0.130) +GGCCCCGTTTTAAA |
24/230 | 5.4 | 52.4% | noncoding (7/73 nt) | rasttk_feature_creation_tool=tRNAscan‑SE | tRNA‑Val‑TAC |
| ? | AssemblyC74_contig_39 | 1 = | 0 (0.000) | intergenic (–/+65) | –/rasttk_feature_creation_tool=RNA_reps_SSU_rRNA | –/SSU rRNA ## 16S rRNA, small subunit ribosomal RNA | |||||