New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	U00096	2817670 =	264 (0.920)	5 (0.020)	4/292	43.1	2.6%	intergenic (‑167/+114)	yqaB/argQ	fructose‑1‑phosphate phosphatase YqaB/tRNA‑Arg
	?	U00096	= 2818216	106 (0.370)					noncoding (59/77 nt)	argY	tRNA‑Arg
Rejected: Coverage evenness skew score above cutoff.
Rejected: Frequency below/above cutoff threshold.

GAGT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  U00096/2817673‑2817670 ‑‑‑‑AATCCTCCCGGATGCACCATCTCTTACTTGATATGGCTTTAGTAGCGGTATCAATATCAGCAGTAAAATAAAT  <  U00096/2818216‑2818144                                                                               GAGTAATCCTCCCGGATGCACCATCTCTTACTTGATATGGCTTTAGTAGCGGTATCAATATCAGCAGTAAAATAGAT  <  2:2740001/77‑1   GTAATCCTCCCGGATGCACCATCTCTTACTTGATATGGCTTTAGTAGCGGTt                         <  1:2740011/52‑2   GTAATCCTCCCGGATGCACCATCTCTTACTTGATATGGCTTTAGTAGCGGTATCAATATCAGCAGTAAAA       <  1:2740030/70‑1   GTAATCCTCCCGGATGCACCATCTCTTACTTGATAAGGCTTTAGTAGCGGTATCAATA                   >  1:2739971/1‑58    TAATCCTCCCGGATGCACCATCTCTTACTTGATATGGCTTTAGTAGCGG                           <  1:2740012/49‑1                                                                               GAGT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  U00096/2817673‑2817670 ‑‑‑‑AATCCTCCCGGATGCACCATCTCTTACTTGATATGGCTTTAGTAGCGGTATCAATATCAGCAGTAAAATAAAT  <  U00096/2818216‑2818144

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.