| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | REL606 | 3594449 = | 367 (1.290) | 4 (0.020) +TGAATATTCA |
3/130 | 11.6 | 1.2% | intergenic (‑340/+28) | yhiW/gadX | DNA‑binding transcriptional activator/DNA‑binding transcriptional dual regulator |
| ? | REL606 | 3594449 = | 367 (1.290) | intergenic (‑340/+28) | yhiW/gadX | DNA‑binding transcriptional activator/DNA‑binding transcriptional dual regulator | |||||
| Rejected: Coverage evenness skew score above cutoff. | |||||||||||
| Rejected: Frequency below/above cutoff threshold. | |||||||||||
ATAAAAAAAACCCG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ < REL606/3594462‑3594449‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑CGGGTTTTTTTTAT > REL606/3594449‑3594462 |||||||||| ATAAAAAAAACCCGTGAATATTCACGGGTTTTTTTTA < 2:740983/37‑1 TAAAAAAAACCCGTGAATATTCACGGGTTTTTTTTAT < 1:2336159/37‑1 TAAAAAAAACCCGTGAATATTCACGGGTTTTTTTTAT < 1:740983/37‑1 TAAAAAAAACCCGTGAATATTCACGGGTTTTTTTTAT > 2:2336159/1‑37 |||||||||| ATAAAAAAAACCCG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ < REL606/3594462‑3594449‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑CGGGTTTTTTTTAT > REL606/3594449‑3594462 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 21 ≤ ATCG/ATCG < 26 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 39 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |