| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | REL606 | 2898279 = | 72 (1.150) | 4 (0.110) +ATGGGCACAATTCATTGCAGTTACGCTCTA |
4/90 | 5.1 | 6.9% | intergenic (+131/+90) | yqeA/yqeB | predicted amino acid kinase/conserved protein with NAD(P)‑binding Rossman fold |
| ? | REL606 | 4353277 = | 110 (1.760) | intergenic (‑332/+63) | yjeJ/yjeK | hypothetical protein/predicted lysine aminomutase | |||||
| Rejected: Coverage evenness skew score above cutoff. | |||||||||||
| Rejected: Frequency below/above cutoff threshold. | |||||||||||
TACGCTTATCAGGCCTACAA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ < REL606/2898298‑2898279‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATGTAGGCCTGATAAGCGTA > REL606/4353277‑4353296 |||||||||||||||||||||||||||||| TACGCTTATCAGGCCTACAAATGGGCACAATTCATTGCAGTTACGCTCTAATGTAGGCCTGATAAGCGTA > 1:1504802/1‑70TACGCTTATCAGGCCTACAAATGGGCACAATTCATTGCAGTTACGCTCTAATGTAGGCCTGATAAGCGTA < 2:1504802/70‑1 CAGGCCTACAAATGGGCACAATTCATTGCAGTTACGCTCTAATGTAGGCCTG > 1:543610/1‑52 CAGGCCTACAAATGGGCACAATTCATTGCAGTTACGCTCTAATGTAGGCCTG < 2:543610/52‑1 |||||||||||||||||||||||||||||| TACGCTTATCAGGCCTACAA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ < REL606/2898298‑2898279‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATGTAGGCCTGATAAGCGTA > REL606/4353277‑4353296 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 11 ≤ ATCG/ATCG < 25 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 38 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |