New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	REL606	= 3529112	85 (1.360)	4 (0.110) +ATGGGCACAATTCATTGCAGTTACGCTCTA	4/90	5.1	7.6%	intergenic (+71/+128)	yhhK/livJ	hypothetical protein/leucine/isoleucine/valine transporter subunit
	?	REL606	3569965 =	78 (1.250)					intergenic (+135/+109)	pitA/yhiO	phosphate transporter, low‑affinity/universal stress protein UspB
Rejected: Coverage evenness skew score above cutoff.
Rejected: Frequency below/above cutoff threshold.

TACGCTTATCAGGCCTACAA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  REL606/3529093‑3529112 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATGTAGGCCTGATAAGCGTA  >  REL606/3569965‑3569984                     ||||||||||||||||||||||||||||||                     TACGCTTATCAGGCCTACAAATGGGCACAATTCATTGCAGTTACGCTCTAATGTAGGCCTGATAAGCGTA  >  1:1504802/1‑70 TACGCTTATCAGGCCTACAAATGGGCACAATTCATTGCAGTTACGCTCTAATGTAGGCCTGATAAGCGTA  <  2:1504802/70‑1          CAGGCCTACAAATGGGCACAATTCATTGCAGTTACGCTCTAATGTAGGCCTG           >  1:543610/1‑52          CAGGCCTACAAATGGGCACAATTCATTGCAGTTACGCTCTAATGTAGGCCTG           <  2:543610/52‑1                     ||||||||||||||||||||||||||||||                     TACGCTTATCAGGCCTACAA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  REL606/3529093‑3529112 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATGTAGGCCTGATAAGCGTA  >  REL606/3569965‑3569984

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 11 ≤ ATCG/ATCG < 25 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 38 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.