New junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | REL606 | = 3529112 | 85 (1.360) | 4 (0.110) +ATGGGCACAATTCATTGCAGTTACGCTCTA |
4/90 | 5.1 | 7.6% | intergenic (+71/+128) | yhhK/livJ | hypothetical protein/leucine/isoleucine/valine transporter subunit |
? | REL606 | 3569965 = | 78 (1.250) | intergenic (+135/+109) | pitA/yhiO | phosphate transporter, low‑affinity/universal stress protein UspB | |||||
Rejected: Coverage evenness skew score above cutoff. | |||||||||||
Rejected: Frequency below/above cutoff threshold. |
TACGCTTATCAGGCCTACAA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ > REL606/3529093‑3529112 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATGTAGGCCTGATAAGCGTA > REL606/3569965‑3569984 |||||||||||||||||||||||||||||| TACGCTTATCAGGCCTACAAATGGGCACAATTCATTGCAGTTACGCTCTAATGTAGGCCTGATAAGCGTA > 1:1504802/1‑70 TACGCTTATCAGGCCTACAAATGGGCACAATTCATTGCAGTTACGCTCTAATGTAGGCCTGATAAGCGTA < 2:1504802/70‑1 CAGGCCTACAAATGGGCACAATTCATTGCAGTTACGCTCTAATGTAGGCCTG > 1:543610/1‑52 CAGGCCTACAAATGGGCACAATTCATTGCAGTTACGCTCTAATGTAGGCCTG < 2:543610/52‑1 |||||||||||||||||||||||||||||| TACGCTTATCAGGCCTACAA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ > REL606/3529093‑3529112 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATGTAGGCCTGATAAGCGTA > REL606/3569965‑3569984 |
Alignment Legend |
---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 11 ≤ ATCG/ATCG < 25 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 38 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
Reads not counted as support for junction |
read_name Not counted due to insufficient overlap past the breakpoint. |
read_name Not counted due to not crossing MOB target site duplication. |