New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	NC_000913	= 1821202	42 (0.550)	4 (0.060) +GGATGCAAG	3/198	7.1	9.0%	coding (13/1359 nt)	chbC	N,N'‑diacetylchitobiose‑specific enzyme IIC component of PTS
	?	NC_000913	= 2148961	46 (0.600)					coding (1288/1353 nt)	yegD	Hsp70 chaperone family protein
Rejected: Coverage evenness skew score above cutoff.
Rejected: Frequency below/above cutoff threshold.

TTCAAGCGATGCAAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  NC_000913/1821188‑1821202 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑CTGCAATCGGAATGC  <  NC_000913/2148961‑2148947                |||||||||                TTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATGC  >  1:423611/1‑39 TTCAAGCGATGCAATGGATGCAAGCTGCAATCGGAATGC  <  2:423611/39‑1 TTCAAGCGATGCAATGGATGCAAGCTGCAATCGGA      >  1:235659/1‑35 TTCAAGCGATGCAATGGATGCAAGCTGCAATCGGA      <  2:235659/35‑1                |||||||||                TTCAAGCGATGCAAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  NC_000913/1821188‑1821202 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑CTGCAATCGGAATGC  <  NC_000913/2148961‑2148947

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 27 ≤ ATCG/ATCG < 34 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 40 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.