![]() |
breseq version 0.33.1 revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Marginal new junction evidence (lowest skew 10 of 21 shown) | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 4542690 | 257 (1.750) | 4 (0.030) | 4/546 | NT | 1.7% | intergenic (+57/‑425) | fimE/fimA | tyrosine recombinase/inversion of on/off regulator of fimA/major type 1 subunit fimbrin (pilin) |
| ? | NC_000913 | = 4542986 | 206 (1.450) | intergenic (+353/‑129) | fimE/fimA | tyrosine recombinase/inversion of on/off regulator of fimA/major type 1 subunit fimbrin (pilin) | |||||
| * | ? | NC_000913 | 4437501 = | 184 (1.250) | 3 (0.020) | 3/544 | NT | 1.6% | intergenic (+6/‑206) | cysQ/ytfI | 3'(2'),5'‑bisphosphate nucleotidase/uncharacterized protein |
| ? | NC_000913 | 4437537 = | 183 (1.290) | intergenic (+42/‑170) | cysQ/ytfI | 3'(2'),5'‑bisphosphate nucleotidase/uncharacterized protein | |||||
| * | ? | NC_000913 | 3873646 = | 136 (0.920) | 5 (0.030) | 4/550 | NT | 3.9% | coding (829/879 nt) | dgoK | 2‑oxo‑3‑deoxygalactonate kinase |
| ? | NC_000913 | 3873729 = | 115 (0.800) | coding (746/879 nt) | dgoK | 2‑oxo‑3‑deoxygalactonate kinase | |||||
| * | ? | NC_000913 | 3539825 = | 151 (1.030) | 3 (0.020) +TCGGAGATATTCTCCGGCAC |
3/524 | NT | 2.1% | intergenic (+119/‑338) | yhgF/feoA | putative transcriptional accessory protein/ferrous iron transporter, protein A |
| ? | NC_000913 | 3539828 = | 149 (1.010) | intergenic (+122/‑335) | yhgF/feoA | putative transcriptional accessory protein/ferrous iron transporter, protein A | |||||
| * | ? | NC_000913 | = 3335385 | 144 (0.980) | 3 (0.020) | 3/552 | NT | 2.2% | coding (1110/1260 nt) | murA | UDP‑N‑acetylglucosamine 1‑carboxyvinyltransferase |
| ? | NC_000913 | = 3335460 | 130 (0.900) | coding (1035/1260 nt) | murA | UDP‑N‑acetylglucosamine 1‑carboxyvinyltransferase | |||||
| * | ? | NC_000913 | = 3173475 | 150 (1.020) | 4 (0.030) | 6/548 | NT | 2.6% | intergenic (+19/+29) | ygiN/parE | quinol monooxygenase/DNA topoisomerase IV, subunit B |
| ? | NC_000913 | = 3173484 | 149 (1.040) | intergenic (+28/+20) | ygiN/parE | quinol monooxygenase/DNA topoisomerase IV, subunit B | |||||
| * | ? | NC_000913 | = 3124701 | 145 (0.990) | 3 (0.020) | 3/554 | NT | 2.1% | coding (759/1224 nt) | glcF | glycolate oxidase 4Fe‑4S iron‑sulfur cluster subunit |
| ? | NC_000913 | = 3124719 | 140 (0.970) | coding (741/1224 nt) | glcF | glycolate oxidase 4Fe‑4S iron‑sulfur cluster subunit | |||||
| * | ? | NC_000913 | 2969289 = | 144 (0.980) | 2 (0.010) | 3/552 | NT | 1.4% | intergenic (‑312/‑373) | rppH/mutH | RNA pyrophosphohydrolase/methyl‑directed mismatch repair protein |
| ? | NC_000913 | 2969303 = | 137 (0.950) | intergenic (‑326/‑359) | rppH/mutH | RNA pyrophosphohydrolase/methyl‑directed mismatch repair protein | |||||
| * | ? | NC_000913 | = 2819348 | 131 (0.890) | 4 (0.030) | 4/546 | NT | 3.0% | intergenic (‑202/+33) | csrA/alaS | pleiotropic regulatory protein for carbon source metabolism/alanyl‑tRNA synthetase |
| ? | NC_000913 | = 2819357 | 131 (0.920) | intergenic (‑211/+24) | csrA/alaS | pleiotropic regulatory protein for carbon source metabolism/alanyl‑tRNA synthetase | |||||
| * | ? | NC_000913 | 2262962 = | 120 (0.820) | 3 (0.020) | 3/558 | NT | 2.4% | coding (534/1131 nt) | fruB | fused fructose‑specific PTS enzymes: IIA component/HPr component |
| ? | NC_000913 | 2262979 = | 122 (0.840) | coding (517/1131 nt) | fruB | fused fructose‑specific PTS enzymes: IIA component/HPr component | |||||