| Predicted mutation | ||||||
|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | annotation | gene | description |
| MC JC | NC_000913 | 257,908 | Δ776 bp | [crl] | [crl] | |
| Missing coverage evidence... | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 257908 | 258683 | 776 | 12 [0] | [0] 13 | [crl] | [crl] |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 257907 | 0 (0.000) | 8 (0.410) | 8/116 | 0.7 | 100% | intergenic (+8/‑769) | crl/crl | pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers/pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers |
| ? | NC_000913 | 258684 = | 0 (0.000) | pseudogene (9/331 nt) | crl | pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers | |||||
GTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCA > NC_000913/257842‑257972 | gTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAag > 1:265885‑M1/1‑66 (MQ=255)gTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAag < 1:417909‑M1/68‑3 (MQ=255) tGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagt < 1:444299‑M1/68‑4 (MQ=255) aGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataatcgatt > 2:5274‑M1/1‑49 (MQ=255) ttGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagattatcgaatctt > 2:452891‑M1/1‑46 (MQ=255) aaTTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataatcgattctttttcgattgt < 1:746961‑M1/68‑33 (MQ=255) cccGTATATTCGTGAAGGTAagtgcaaagataatcgattctttttcgattgtctggctgtatgcgtca > 2:45821‑M1/1‑20 (MQ=255) cGTGAAGGTAagtgcaaagataatcgattctttttcgattgtctggctgtatgcgtcaacgtgaaacc > 2:734783‑M1/1‑10 (MQ=255) tagGTAagtgcaaagataatcgattctttttcgattgtcgggctgtatgcgtcaacgtgaaaccggca < 1:443683‑M1/67‑63 (MQ=255) aGGTAagtgcaaagataatcgattctttttcgattgtctggctgtatgcgtcaacgtgaaaccggcac > 1:194175‑M1/1‑5 (MQ=255) ggTAagtgcaaagataatcgattctttttcgattgtctggctgtatgcgtcaacgtgaaaccggcacc > 1:100054‑M1/1‑4 (MQ=255) gTAagtgcaaagataatcgattctttttcgattgtctggctgtatgcgtcaacgtgaaaccggcaccg > 2:232368‑M1/1‑3 (MQ=255) | GTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCA > NC_000913/257842‑257972 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 13 ≤ ATCG/ATCG < 27 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |