Predicted mutation | ||||||
---|---|---|---|---|---|---|
evidence | seq id | position | mutation | annotation | gene | description |
MC JC | NC_000913 | 257,908 | Δ776 bp | [crl] | [crl] |
Missing coverage evidence... | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
seq id | start | end | size | ←reads | reads→ | gene | description | |||
* | * | ÷ | NC_000913 | 257908 | 258683 | 776 | 16 [0] | [0] 16 | [crl] | [crl] |
New junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | NC_000913 | = 257907 | 0 (0.000) | 16 (0.980) | 12/116 | 0.2 | 100% | intergenic (+8/‑769) | crl/crl | pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers/pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers |
? | NC_000913 | 258684 = | 0 (0.000) | pseudogene (9/331 nt) | crl | pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers |
TGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTG > NC_000913/257843‑257965 | ttgacACCCGAAGAGCAGATAGATCAAAAAATTTACCTCACTATGCCCGTATATTCGTGAAGGTAagt < 1:477362‑M1/66‑4 (MQ=255) tGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagt < 1:392864‑M1/68‑4 (MQ=255) ggACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtg < 1:415763‑M1/68‑5 (MQ=255) ggACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtg < 2:22718‑M1/68‑5 (MQ=255) aaGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataa < 2:500869‑M1/68‑14 (MQ=255) agagCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataat > 2:19604‑M1/1‑54 (MQ=255) agCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataatcg > 1:444493‑M1/1‑52 (MQ=255) gATCAAAAATTTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataatcgattctttt < 1:400282‑M1/68‑25 (MQ=255) aaaTTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataatcgagtctttttcgattg > 2:268820‑M1/1‑37 (MQ=255) aaTTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataatcgattctttttcgattgt < 1:218131‑M1/68‑33 (MQ=255) ccGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataatcgattctttttcgattgtctggct > 2:608965‑M1/1‑30 (MQ=255) gCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataatcgattctttttcgattgtctggctgt < 1:19604‑M1/68‑41 (MQ=255) cccGTATTTTCGTGAAGGTAagtgcaaagataatcgattctttttcgattgtctggctgtatgcgtca > 2:523798‑M1/1‑20 (MQ=255) cccGTATATTCGTGAAGGTAagtgcaaagataatcgattctttttcgattgtctggctgtatgcgtca > 1:256708‑M1/1‑20 (MQ=255) cccGTATATTCGTGAAGGTAagtgcaaagataatcgattctttttcgattgtctggctgtatgcgtca > 2:522953‑M1/1‑20 (MQ=255) cGTGAAGGTAagtgcaaagataatcgattctttttcgattgtctggctgtatgcgtcaacgtgaaacc > 2:268252‑M1/1‑10 (MQ=255) | TGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTG > NC_000913/257843‑257965 |
Alignment Legend |
---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 8 ≤ ATCG/ATCG < 22 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |