| Predicted mutation | ||||||
|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | annotation | gene | description |
| MC JC | NC_000913 | 257,908 | Δ776 bp | [crl] | [crl] | |
| Missing coverage evidence... | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 257908–258675 | 258683 | 9–776 | 17 [0] | [0] 17 | [crl] | [crl] |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 257907 | 0 (0.000) | 16 (0.810) | 12/116 | 0.3 | 100% | intergenic (+8/‑769) | crl/crl | pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers/pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers |
| ? | NC_000913 | 258684 = | 0 (0.000) | pseudogene (9/331 nt) | crl | pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers | |||||
TGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATG > NC_000913/257843‑257970 | tGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagt < 2:98584‑M1/68‑4 (MQ=255) ggACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtg < 2:670737‑M1/68‑5 (MQ=255) aaGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataa < 1:287178‑M1/68‑14 (MQ=255) aaGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataa < 1:79200‑M1/68‑14 (MQ=255) agCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataatcg > 1:190993‑M1/1‑52 (MQ=255) agCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataatcg > 2:225739‑M1/1‑52 (MQ=255) agCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataatcg > 2:390581‑M1/1‑52 (MQ=255) gATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataatcgattc > 2:368878‑M1/1‑48 (MQ=255) atgATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataatcgattctt < 1:809915‑M1/67‑23 (MQ=255) cAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAagtgcaaagataatcgattctttttcg > 1:491909‑M1/1‑41 (MQ=255) gCACTAGGCCCGTATTTTCGTGAAGGTAagttcaatgataatcgattctttttcgattgtctttctgt < 1:591376‑M1/68‑41 (MQ=255) gCCCGTATATTCGTGAAGGTAagtgcaaagataatcgattcttattcgattgtctggctgtatgcgtc > 1:236761‑M1/1‑21 (MQ=255) cccGTATATTCGTGAAGGTAagtgcaaagataatcgattctttttcgattgtctggctgtatgcgtca > 2:475911‑M1/1‑20 (MQ=255) tatTCGTGAAGGTAagtgctaagataatcgattctttttcgattgtctggctgtatgcgtcaacgtga > 2:103592‑M1/1‑14 (MQ=255) cGTGAAGGTAagtgcaaagataatcgattctttttcgattgtctggctgtatgcgtcaacgtgaaacc > 2:620545‑M1/1‑10 (MQ=255) cGTGAAGGTAagtgcaaagataatcgattctttttcgattgtctggctgtatgcgtcaacgtgaaacc > 1:530496‑M1/1‑10 (MQ=255) aGGTAagtgcaaagataatcgattctttttcgattgtctggctgtatgcgtcaacgtgaaaccggcac > 2:713297‑M1/1‑5 (MQ=255) | TGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATG > NC_000913/257843‑257970 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 13 ≤ ATCG/ATCG < 22 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |