Predicted mutation
evidence seq id position mutation annotation gene description
JC JC NC_000913 1,293,032 IS1 (–) +8 bp intergenic (‑110/‑488) hns ← / → tdk global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase

New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 257908 =NA (NA)51 (1.000) 43/284 0.2 100% noncoding (768/768 nt) IS1 repeat region
?NC_000913 = 1293039 0 (0.000)intergenic (‑117/‑488) hns/tdk global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase
* ? NC_000913 1293032 =0 (0.000)54 (1.060) 48/284 0.1 100% intergenic (‑110/‑495) hns/tdk global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase
?NC_000913 = 1979270 NA (NA)noncoding (1/768 nt) IS1 repeat region

TAAAAATTTGCTAAATTTTGCCAATTTGGTAAAACAGTTGCATCACAACAGGAGATAGCAATGACGTTACCGAGTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTA  >  NC_000913/257769‑257911
                                                                                                                                           |   
tAAAAATTTGCTAAATTTAGCCAATTTGGTAGAAAAGTTGAATAACAACAGGAGATAGCTGTGAAGTTACCGAGTGGACACCCGAAGAGCAGATTGATCAATGACTTTAAAGATTAAGGCCCGTATATTCGTGAaggtaagtg  <  2:17692/143‑2 (MQ=255)
                                                                                                                                           |   
TAAAAATTTGCTAAATTTTGCCAATTTGGTAAAACAGTTGCATCACAACAGGAGATAGCAATGACGTTACCGAGTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTA  >  NC_000913/257769‑257911

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 12 ≤ ATCG/ATCG < 13 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.