New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	NC_000913	257908 =	NA (NA)	86 (1.300)	70/284	0.0	96.6%	intergenic (+9/‑768)	crl/crl	pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator,regulator, Surface structures, transcriptional regulator of cryptic csgA gene for curli surface fibers/pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator,regulator, Surface structures, transcriptional regulator of cryptic csgA gene for curli surface fibers
	?	NC_000913	= 1293039	3 (0.050)					intergenic (‑117/‑488)	hns/tdk	global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase

AATTTTGCCAATTTGGTAAAACAGTTGCATCACAACAGGAGATAGCAATGACGTTACCGAGTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTAATGACTCCAACTT  >  NC_000913/257782‑257924                                                                                                                               |                 aaTGTTGCCAAGGTGGTGAAGCACTTCGATCACAACAGGAGATAGCAAGGCCGCTACCGAGTGGACACCCGAAGAGTAGATTGATCAAAAAACTTACCGCACTTCGCCCGTATATTCGTGAaggtaagtgcaaagataatcga  <  1:456722/143‑15 (MQ=255)                                                                                                                               |                 AATTTTGCCAATTTGGTAAAACAGTTGCATCACAACAGGAGATAGCAATGACGTTACCGAGTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTAATGACTCCAACTT  >  NC_000913/257782‑257924

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 8 ≤ ATCG/ATCG < 12 ≤ ATCG/ATCG < 13 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.