| Predicted mutation | ||||||
|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | annotation | gene | description |
| MC JC | NC_000913 | 819,776 | Δ62,977 bp | ybhL–deoR | 57 genes ybhL, ybhM, ybhN, clsB, ybhP, ybhQ, ybhR, ybhS, ybhF, ybhG, cecR, rhlE, ybiA, dinG, ybiB, hcxB, ybiJ, ybiI, ybiX, fiu, mcbA, rlmF, ybiO, glnQ, glnP, glnH, dps, rhtA, yliM, ompX, opgE, rybA, mntS, mntR, ybiR, ldtB, ybiT, ybiU, ybiV, ybiW, ybiY, fsaA, moeB, moeA, iaaA, gsiA, gsiB, gsiC, gsiD, pdeI, dgcI, rimO, bssR, yliI, gstB, dacC, deoR |
|
| Missing coverage evidence... | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 819776 | 882752 | 62977 | 24 [0] | [0] 25 | ybhL–deoR | ybhL,ybhM,ybhN,clsB,ybhP,ybhQ,ybhR,ybhS,ybhF,ybhG,cecR,rhlE,ybiA,dinG,ybiB,hcxB,ybiJ,ybiI,ybiX,fiu,mcbA,rlmF,ybiO,glnQ,glnP,glnH,dps,rhtA,yliM,ompX,opgE,rybA,mntS,mntR,ybiR,ldtB,ybiT,ybiU,ybiV,ybiW,ybiY,fsaA,moeB,moeA,iaaA,gsiA,gsiB,gsiC,gsiD,pdeI,dgcI,rimO,bssR,yliI,gstB,dacC,deoR |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 819775 | NA (NA) | 24 (0.790) | 21/96 | 0.2 | 100% | noncoding (17/27 nt) | REPt74 | REPt74 |
| ? | NC_000913 | 882753 = | 0 (0.000) | intergenic (‑19/+39) | deoR/ybjG | DNA‑binding transcriptional repressor DeoR/undecaprenyl pyrophosphate phosphatase | |||||
CCCGATACGCTCTTCGCGACGTGTTTCCATAATCCCTCTGAATAGTTATTGAAGCGAGCCGCTCAATACTACACTTTTTAGCAGAGATCAGTCACG > NC_000913/882705‑882800 | aggcggcaaaacgctggtagttttttgttagccggataaggcaccgctt > 1:1209780‑M2/49‑49 (MQ=255) cggcaaaacgctggtagttttttgttagccggataaggcaccgctTTGa < 1:2183367‑M2/4‑1 (MQ=255) cggcaaaacgctggtagttttttgttagccggataaggcaccgctTTGa < 1:1746068‑M2/4‑1 (MQ=255) caaaacgctggtagttttttgttagccggataaggcaccgctTTGAAGc > 1:1407462‑M2/43‑49 (MQ=255) aaaacgctggtagttttttgttagccggataaggcaccgctTTGAAGCg < 1:1251679‑M2/8‑1 (MQ=255) aaacgctggtagttttttgttagccggataaggcaccgctTTGAAGCGa < 1:1036206‑M2/9‑1 (MQ=255) acgctggtagttttttgttagccggataaggcaccgctTTGAAGCGAGc > 1:51086‑M2/39‑49 (MQ=255) ctggtagttttttgttagccggataaggcaccgctTTGAAGCGAGCCGc > 1:1805780‑M2/36‑49 (MQ=255) ggtagttttttgttagccggataaggcaccgctTTGAAGCGAGCCGCt > 1:1929809‑M2/34‑48 (MQ=255) agttttttgttagccggataaggcaccgctTTGAAGCGAGCCGCTCaa > 1:1240449‑M2/31‑48 (MQ=255) gttttttgttagccggataaggcaccgctTTGAAGCGAGCCGCTCAAta > 1:1457274‑M2/30‑49 (MQ=255) ttagccggataaggcaccgctTTGAAGCGAGCCGCTCAATACTACACtt < 1:1202516‑M2/28‑1 (MQ=255) ttagccggataaggcaccgctTTGAAGCGAGCCGCTCAATACTACACtt < 1:1358288‑M2/28‑1 (MQ=255) agccggataaggcaccgctTTGAAGCGAGCCGCTCAATACTACACtttt > 1:282406‑M2/20‑49 (MQ=255) gccggataaggcaccgctTTGAAGCGAGCCGCTCAATACTACACtttt < 1:935293‑M2/30‑1 (MQ=255) ggataaggcaccgctTTGAAGCGAGCCGCTCAATACTACACTTTTTAg > 1:2054555‑M2/16‑48 (MQ=255) ggataaggcaccgctTTGAAGCGAGCCGCTCAATACTACACTTTTTAg > 1:909375‑M2/16‑48 (MQ=255) ggataaggcaccgctTTGAAGCGAGCCGCTCAATACTACACTTTTTAGc < 1:58388‑M2/34‑1 (MQ=255) gataaggcaccgctTTGAAGCGAGCCGCTCAATACTACACTTTTTAg > 1:1742142‑M2/15‑47 (MQ=255) taaggcaccgctTTGAAGCGAGCCGCTCAATACTACACTTTTTAGCaga < 1:61935‑M2/37‑1 (MQ=255) ggcaccgctTTGAAGCGAGCCGCTCAATACTACACTTTTTAGCAGAGAt < 1:1742303‑M2/40‑1 (MQ=255) gcaccgctTTGAAGCGAGCCGCTCAATACTACACTTTTTAGCAGAGATc < 1:1671940‑M2/41‑1 (MQ=255) cgctTTGAAGCGAGCCGCTCAATACTACACTTTTTAGCAGAGATCAGt > 1:1802353‑M2/5‑48 (MQ=255) gctTTGAAGCGAGCCGCTCAATACTACACTTTTTAGCAGAGATCAGTCa > 1:1010027‑M2/4‑49 (MQ=255) ttGAAGCGAGCCGCTCAATACTACACTTTTTAGCAGAGATCAGTCACg > 1:43155/1‑48 (MQ=255) | CCCGATACGCTCTTCGCGACGTGTTTCCATAATCCCTCTGAATAGTTATTGAAGCGAGCCGCTCAATACTACACTTTTTAGCAGAGATCAGTCACG > NC_000913/882705‑882800 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 34 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 39 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |