mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.33.1 revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||
|---|---|---|---|---|---|
| evidence | position | mutation | annotation | gene | description |
| RA | 29,630 | G→T | intergenic (+435/‑21) | dapB → / → carA | dihydrodipicolinate reductase/carbamoyl phosphate synthetase small subunit, glutamine amidotransferase |
| MC JC | 257,908 | Δ776 bp | [crl] | [crl] | |
| JC JC | 1,293,196 | IS5 (+) +4 bp | intergenic (‑274/‑328) | hns ← / → tdk | global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase |
| MC JC | 1,978,503 | Δ776 bp | insB1–insA | insB1, insA | |
| JC JC | 1,979,486 | IS5 (+) +4 bp | intergenic (‑271/‑264) | insA ← / → uspC | IS1 repressor TnpA/universal stress protein |
| RA | 2,173,363 | Δ2 bp | intergenic (‑1/+1) | gatC ← / ← gatC | pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC |
| RA | 2,628,644 | A→T | C99S (TGT→AGT) | yfgF ← | cyclic‑di‑GMP phosphodiesterase, anaerobic |
| RA | 3,181,174 | G→A | G252S (GGC→AGC) | ygiC → | ATP‑Grasp family ATPase |
| RA | 3,560,455 | +G | intergenic (‑2/+1) | glpR ← / ← glpR | pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon |
| MC JC | 3,815,859 | Δ82 bp | [rph]–[rph] | [rph], [rph] | |
| JC | 4,002,124 | (CTGCCGCATAACGAATCCCTG)1→2 | coding (699/951 nt) | corA → | magnesium/nickel/cobalt transporter |
| RA | 4,131,175 | Δ1 bp | coding (1341/2433 nt) | metL → | Bifunctional aspartokinase/homoserine dehydrogenase 2 |
| RA | 4,182,881 | A→T | E546V (GAA→GTA) | rpoB → | RNA polymerase, beta subunit |
| RA | 4,296,381 | +GC | intergenic (+587/+55) | gltP → / ← yjcO | glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein |
| RA | 4,510,524 | C→A | intergenic (+391/+166) | yjhV → / ← fecE | pseudogene, KpLE2 phage‑like element/ferric citrate ABC transporter ATPase |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 3423769–3424233 | 3424511–3424238 | 6–743 | 62 [61] | [61] 62 | [rrfD]–[rrlD] | [rrfD],[rrlD] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 1207790 = | 24 (0.140) | 177 (1.180) | 96/298 | 0.1 | 90.6% | coding (290/630 nt) | stfP | e14 prophage; uncharacterized protein |
| ? | NC_000913 | 1209619 = | 15 (0.100) | pseudogene (1/501 nt) | stfE | pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related | |||||
| * | ? | NC_000913 | = 1207805 | 24 (0.140) | 118 (0.790) | 75/298 | 0.4 | 86.6% | coding (305/630 nt) | stfP | e14 prophage; uncharacterized protein |
| ? | NC_000913 | = 1209602 | 15 (0.100) | pseudogene (18/501 nt) | stfE | pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related | |||||
| * | ? | NC_000913 | = 1299498 | 0 (0.000) | 98 (0.610) | 67/322 | 0.9 | 100% | intergenic (+253/‑1684) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein |
| ? | NC_000913 | 1300698 = | 0 (0.000) | intergenic (+1453/‑484) | ychE/oppA | UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein | |||||