breseq  version 0.33.1  revision 8505477f25b3
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation annotation gene description
RA 29,630 G→T intergenic (+435/‑21) dapB → / → carA dihydrodipicolinate reductase/carbamoyl phosphate synthetase small subunit, glutamine amidotransferase
MC JC 257,908 Δ776 bp [crl] [crl]
JC JC 1,293,196 IS5 (+) +4 bp intergenic (‑274/‑328) hns ← / → tdk global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase
MC JC 1,978,503 Δ776 bp insB1insA insB1, insA
JC JC 1,979,486 IS5 (+) +4 bp intergenic (‑271/‑264) insA ← / → uspC IS1 repressor TnpA/universal stress protein
RA 2,173,363 Δ2 bp intergenic (‑1/+1) gatC ← / ← gatC pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC/pseudogene, galactitol‑specific enzyme IIC component of PTS;transport; Transport of small molecules: Carbohydrates, organic acids, alcohols; PTS system galactitol‑specific enzyme IIC
RA 2,628,644 A→T C99S (TGT→AGT)  yfgF ← cyclic‑di‑GMP phosphodiesterase, anaerobic
RA 3,181,174 G→A G252S (GGC→AGC)  ygiC → ATP‑Grasp family ATPase
RA 3,560,455 +G intergenic (‑2/+1) glpR ← / ← glpR pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon/pseudogene, DNA‑binding transcriptional repressor;regulator; Energy metabolism, carbon: Anaerobic respiration; repressor of the glp operon
MC JC 3,815,859 Δ82 bp [rph][rph] [rph], [rph]
JC 4,002,124 (CTGCCGCATAACGAATCCCTG)1→2 coding (699/951 nt) corA → magnesium/nickel/cobalt transporter
RA 4,131,175 Δ1 bp coding (1341/2433 nt) metL → Bifunctional aspartokinase/homoserine dehydrogenase 2
RA 4,182,881 A→T E546V (GAA→GTA)  rpoB → RNA polymerase, beta subunit
RA 4,296,381 +GC intergenic (+587/+55) gltP → / ← yjcO glutamate/aspartate:proton symporter/Sel1 family TPR‑like repeat protein
RA 4,510,524 C→A intergenic (+391/+166) yjhV → / ← fecE pseudogene, KpLE2 phage‑like element/ferric citrate ABC transporter ATPase

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ NC_000913 3423769–3424233 3424511–3424238 6–743 62 [61] [61] 62 [rrfD]–[rrlD] [rrfD],[rrlD]

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 1207790 =24 (0.140)177 (1.180) 96/298 0.1 90.6% coding (290/630 nt) stfP e14 prophage; uncharacterized protein
?NC_000913 1209619 = 15 (0.100)pseudogene (1/501 nt) stfE pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related
* ? NC_000913 = 120780524 (0.140)118 (0.790) 75/298 0.4 86.6% coding (305/630 nt) stfP e14 prophage; uncharacterized protein
?NC_000913 = 1209602 15 (0.100)pseudogene (18/501 nt) stfE pseudogene, e14 prophage; side tail fiber protein fragment family;Phage or Prophage Related
* ? NC_000913 = 12994980 (0.000)98 (0.610) 67/322 0.9 100% intergenic (+253/‑1684) ychE/oppA UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein
?NC_000913 1300698 = 0 (0.000)intergenic (+1453/‑484) ychE/oppA UPF0056 family inner membrane protein/oligopeptide ABC transporter periplasmic binding protein