New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 4094379 =21 (0.410)4 (0.080) 3/242 NT 17.8% noncoding (64/402 nt) REP299 (repetitive extragenic palindromic) element; contains 9 REP sequences REP299 (repetitive extragenic palindromic) element; contains 9 REP sequences
?NC_000913 4094606 = 17 (0.350)noncoding (291/402 nt) REP299 (repetitive extragenic palindromic) element; contains 9 REP sequences REP299 (repetitive extragenic palindromic) element; contains 9 REP sequences
Rejected: Coverage evenness skew score above cutoff.

AGGCCTACAGGTCGGCAATAGTTGTAGGCCTGATAAG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  NC_000913/4094415‑4094379
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑gataagGCACTTGTGCCGCATCCGGCAATCAATGCCTGATGCGACGCTGTCGCGTCTTATCAGGCCTACAACTGTTG  >  NC_000913/4094606‑4094676
                                                                                                            
AGGCCTACAGGTCGGCAATAGTTGTAGGCCTGATAAGGCACTTGTGCCGCATCCGGCAATCAATGCCTGATGCGACGCTGTCGCGTCTTATCAGGCCTACAACTGTTG  <  3:320428/108‑1
AGGCCTACAGGTCGGCAATAGTTGTAGGCCTGATAAGGCACTTGTGCCGCATCCGGCAATCAATGCCTGATGCGACGCTGTCGCGTCTTATCAGGCCTACAACTGTTG  >  4:320428/1‑108
AGGCCTACAGGTCGGCAATAGTTGTAGGCCTGATAAGGCACTTGTGCCGCATCCGGCAATCAATGCCTGA                                        <  1:244703/70‑1
AGGCCTACAGGTCGGCAATAGTTGTAGGCCTGATAAGGCACTTGTGCCGCATCCGGCAATCAATGCCTGA                                        >  2:244703/1‑70
                                                                                                            
AGGCCTACAGGTCGGCAATAGTTGTAGGCCTGATAAG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  NC_000913/4094415‑4094379
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑gataagGCACTTGTGCCGCATCCGGCAATCAATGCCTGATGCGACGCTGTCGCGTCTTATCAGGCCTACAACTGTTG  >  NC_000913/4094606‑4094676

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 30 ≤ ATCG/ATCG < 34 ≤ ATCG/ATCG < 38 ≤ ATCG/ATCG < 40 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap:     Deleted base: 
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.