| Predicted mutation | |||||||
|---|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | freq | annotation | gene | description |
| MC JC | NC_000913 | 3,582,206 | Δ1,222 bp | 100% | IS1‑mediated | [yhhZ]–yrhA | [yhhZ], yrhA |
| Missing coverage evidence... | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 3582206 | 3584153–3583427 | 1222–1948 | 189 [1] | [93] 96 | [yhhZ]–[insB1] | [yhhZ], yrhA, insA, [insB1] |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 3582205 | 1 (0.010) | 164 (1.180) | 92/178 | NT | 99.4% | coding (343/1179 nt) | yhhZ | putative Hcp1 family polymorphic toxin protein; putative colicin‑like DNase/tRNase activity |
| ? | NC_000913 | 3583428 = | NA (NA) | noncoding (1/768 nt) | IS1 | repeat region | |||||
ATTTTATAGAAATAATGATGATTTCATAAACCCTGATCTACAAGAACGGTTAGTGATCGGGGATTATAGCATTTCAATATTTACTTATGACATTAAAGGT > NC_000913/3583331‑3583430 | aTTTTATAGAAATAATGATGATTTCATAAACCCTGATCTACAAGAACGGTTAGTGATCGGGGATTATAGCATTTCAATATTTACTTATGACATTAAAGGt < 2:1547132/100‑1 (MQ=255) | ATTTTATAGAAATAATGATGATTTCATAAACCCTGATCTACAAGAACGGTTAGTGATCGGGGATTATAGCATTTCAATATTTACTTATGACATTAAAGGT > NC_000913/3583331‑3583430 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |