Predicted mutation
evidence seq id position mutation freq annotation gene description
MC JC NC_000913 3,582,206 Δ1,222 bp 100% IS1‑mediated [yhhZ]yrhA [yhhZ], yrhA

Missing coverage evidence...
   seq id start end size ←reads reads→ gene description
* * ÷ NC_000913 3582206 3584153–3583427 1222–1948 189 [1] [93] 96 [yhhZ]–[insB1] [yhhZ], yrhA, insA, [insB1]

New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 = 35822051 (0.010)164 (1.180) 92/178 NT 99.4% coding (343/1179 nt) yhhZ putative Hcp1 family polymorphic toxin protein; putative colicin‑like DNase/tRNase activity
?NC_000913 3583428 = NA (NA)noncoding (1/768 nt) IS1 repeat region

ATTTTATAGAAATAATGATGATTTCATAAACCCTGATCTACAAGAACGGTTAGTGATCGGGGATTATAGCATTTCAATATTTACTTATGACATTAAAGGT  >  NC_000913/3583331‑3583430
                                                                                                 |  
aTTTTATAGAAATAATGATGATTTCATAAACCCTGATCTACAAGAACGGTTAGTGATCGGGGATTATAGCATTTCAATATTTACTTATGACATTAAAGGt  <  2:1547132/100‑1 (MQ=255)
                                                                                                 |  
ATTTTATAGAAATAATGATGATTTCATAAACCCTGATCTACAAGAACGGTTAGTGATCGGGGATTATAGCATTTCAATATTTACTTATGACATTAAAGGT  >  NC_000913/3583331‑3583430

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap:     Deleted base: 
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.