| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 1468681 | NA (NA) | 53 (0.760) +ACACCATGTTATCGGAGAGCTGCCAACGTATGGTTATCGTCGGG |
12/90 | NT | NA | noncoding (560/1331 nt) | IS2 | repeat region |
| ? | NC_000913 | 1650843 = | NA (NA) | noncoding (1/706 nt) | IS2 | repeat region | |||||
No reads uniquely aligned to region.