Predicted mutation
evidence seq id position mutation annotation gene description
MC JC NC_000913 3,582,206 Δ1,222 bp IS1‑mediated [yhhZ]–yrhA [yhhZ], yrhA

Missing coverage evidence...
   seq id start end size ←reads reads→ gene description
* * ÷ NC_000913 3582206 3584141–3583427 1222–1936 155 [0] [55] 58 [yhhZ]–[insB1] [yhhZ], yrhA, insA, [insB1]

New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 = 35822050 (0.000)153 (1.350) 89/198 0.1 100% coding (343/1179 nt) yhhZ putative Hcp1 family polymorphic toxin protein; putative colicin‑like DNase/tRNase activity
?NC_000913 3583428 = NA (NA)noncoding (1/768 nt) IS1 repeat region

AATGATGATTTCATAAACCCTGATCTACAAGAACGGTTAGTGATCGGGGATTATAGCATTTCAATATTTACTTATGACATTAAAGGTGATGCTGCCAACT  >  NC_000913/3583344‑3583443
                                                                                    |               
aatGATGATTTCATAAACCCTGATCTACAAGAACGGTTAGTGATCGGGGATTATAGCATTTCAATATTTACTTATGACATTAAAGGTGATGCTGCCAACt  <  2:1842056/100‑1 (MQ=255)
                                                                                    |               
AATGATGATTTCATAAACCCTGATCTACAAGAACGGTTAGTGATCGGGGATTATAGCATTTCAATATTTACTTATGACATTAAAGGTGATGCTGCCAACT  >  NC_000913/3583344‑3583443

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.