Predicted mutation | ||||||
---|---|---|---|---|---|---|
evidence | seq id | position | mutation | annotation | gene | description |
MC JC | NC_000913 | 3,582,206 | Δ1,222 bp | IS1‑mediated | [yhhZ]–yrhA | [yhhZ], yrhA |
Missing coverage evidence... | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
seq id | start | end | size | ←reads | reads→ | gene | description | |||
* | * | ÷ | NC_000913 | 3582206 | 3584141–3583427 | 1222–1936 | 155 [0] | [55] 58 | [yhhZ]–[insB1] | [yhhZ], yrhA, insA, [insB1] |
New junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | NC_000913 | = 3582205 | 0 (0.000) | 153 (1.350) | 89/198 | 0.1 | 100% | coding (343/1179 nt) | yhhZ | putative Hcp1 family polymorphic toxin protein; putative colicin‑like DNase/tRNase activity |
? | NC_000913 | 3583428 = | NA (NA) | noncoding (1/768 nt) | IS1 | repeat region |
AATGATGATTTCATAAACCCTGATCTACAAGAACGGTTAGTGATCGGGGATTATAGCATTTCAATATTTACTTATGACATTAAAGGTGATGCTGCCAACT > NC_000913/3583344‑3583443 | aatGATGATTTCATAAACCCTGATCTACAAGAACGGTTAGTGATCGGGGATTATAGCATTTCAATATTTACTTATGACATTAAAGGTGATGCTGCCAACt < 2:1842056/100‑1 (MQ=255) | AATGATGATTTCATAAACCCTGATCTACAAGAACGGTTAGTGATCGGGGATTATAGCATTTCAATATTTACTTATGACATTAAAGGTGATGCTGCCAACT > NC_000913/3583344‑3583443 |
Alignment Legend |
---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
Reads not counted as support for junction |
read_name Not counted due to insufficient overlap past the breakpoint. |
read_name Not counted due to not crossing MOB target site duplication. |