New junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | NC_000913 | = 4171625 | 1 (0.010) | 90 (0.710) | 22/186 | 10.5 | 99.0% | intergenic (+81/‑12) | rrlB/rrfB | 23S ribosomal RNA of rrnB operon/5S ribosomal RNA of rrnB operon |
? | NC_000913 | = 4213004 | NA (NA) | intergenic (+58/‑36) | rrlE/rrfE | 23S ribosomal RNA of rrnE operon/5S ribosomal RNA of rrnE operon | |||||
Rejected: Coverage evenness skew score above cutoff. |
GGCTTAACCTTACAACGCCGAAGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAAC > NC_000913/4171534‑4171630 | ggtttAGCCTTACAACGCCGACGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAAc < 2:3057336/94‑1 (MQ=0) | GGCTTAACCTTACAACGCCGAAGCTGTTTTGGCGGATGAGAGAAGATTTTCAGCCTGATACAGATTAAATCAGAACGCAGAAGCGGTCTGATAAAAC > NC_000913/4171534‑4171630 |
Alignment Legend |
---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 12 ≤ ATCG/ATCG < 13 ≤ ATCG/ATCG < 22 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
Reads not counted as support for junction |
read_name Not counted due to insufficient overlap past the breakpoint. |
read_name Not counted due to not crossing MOB target site duplication. |