| Predicted mutation | ||||||
|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | annotation | gene | description |
| MC JC | NC_000913 | 3,915,584 | 6827 bp→TGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGAACTGCAGGTCGACGGATCCCCGGAAT | [atpC]–[atpI] | [atpC], atpD, atpG, atpA, atpH, atpF, atpE, atpB, [atpI] | |
| Missing coverage evidence... | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_000913 | 3915584 | 3922410 | 6827 | 63 [0] | [0] 58 | [atpC]–[atpI] | [atpC], atpD, atpG, atpA, atpH, atpF, atpE, atpB, [atpI] |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 3915583 | 0 (0.000) | 38 (1.240) | 35/256 | 0.0 | 100% | coding (390/420 nt) | atpC | F1 sector of membrane‑bound ATP synthase, epsilon subunit |
| ? | NC_000913 | 3922411 = | 0 (0.000) | coding (30/381 nt) | atpI | ATP synthase, membrane‑bound accessory factor | |||||
