New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	W3110S.gb	97398 =	38 (1.670)	3 (0.140)	3/98	NT	9.3%	coding (312/1317 nt)	murD	UDP‑N‑acetylmuramoyl‑L‑alanine:D‑glutamate ligase
	?	W3110S.gb	97426 =	22 (1.010)					coding (340/1317 nt)	murD	UDP‑N‑acetylmuramoyl‑L‑alanine:D‑glutamate ligase

TAGAACCGGTAATCGCCACAATCGGTGCT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  W3110S.gb/97426‑97398 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ctAACGGCAAAAGCACGGTCACCACGCTAGTGGGTGAAATGGCGAAAGCGGCGG  >  W3110S.gb/97426‑97477                                                                                   TAGAACCGGAAATCGCCACAATCGGTGCTAACGGCAAAAGCACGGTCACCACGCTAGTGGGTGAAATGGC             >  1:265248/1‑70   GAACCGGTAATCGCCACAATCGGTGCTAACGGCAAAAGCACGGTCACCACGCTAGTGGGTGAAATGGCGA           <  1:2007035/70‑1            ATCGCCACAATCGGTGCTAACGGCAAAAGCACGGTCACCACGCTAGTGGGTGAAATGGCGAAAGCGGCGG  <  1:110616/70‑1                                                                                   TAGAACCGGTAATCGCCACAATCGGTGCT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  W3110S.gb/97426‑97398 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ctAACGGCAAAAGCACGGTCACCACGCTAGTGGGTGAAATGGCGAAAGCGGCGG  >  W3110S.gb/97426‑97477

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.