New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? W3110S.gb 97398 =38 (1.670)3 (0.140) 3/98 NT 9.3% coding (312/1317 nt) murD UDP‑N‑acetylmuramoyl‑L‑alanine:D‑glutamate ligase
?W3110S.gb 97426 = 22 (1.010)coding (340/1317 nt) murD UDP‑N‑acetylmuramoyl‑L‑alanine:D‑glutamate ligase

TAGAACCGGTAATCGCCACAATCGGTGCT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  W3110S.gb/97426‑97398
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ctAACGGCAAAAGCACGGTCACCACGCTAGTGGGTGAAATGGCGAAAGCGGCGG  >  W3110S.gb/97426‑97477
                                                                                 
TAGAACCGGAAATCGCCACAATCGGTGCTAACGGCAAAAGCACGGTCACCACGCTAGTGGGTGAAATGGC             >  1:265248/1‑70
  GAACCGGTAATCGCCACAATCGGTGCTAACGGCAAAAGCACGGTCACCACGCTAGTGGGTGAAATGGCGA           <  1:2007035/70‑1
           ATCGCCACAATCGGTGCTAACGGCAAAAGCACGGTCACCACGCTAGTGGGTGAAATGGCGAAAGCGGCGG  <  1:110616/70‑1
                                                                                 
TAGAACCGGTAATCGCCACAATCGGTGCT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  W3110S.gb/97426‑97398
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ctAACGGCAAAAGCACGGTCACCACGCTAGTGGGTGAAATGGCGAAAGCGGCGG  >  W3110S.gb/97426‑97477

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.