| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | minE | 2068717 = | 90 (1.470) | 5 (0.090) +ACTG |
3/90 | NT | 8.4% | coding (1073/1521 nt) | aer | fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component |
| ? | minE | 2786335 = | 29 (0.470) | coding (784/873 nt) | yjbC | 23S rRNA pseudouridine synthase | |||||
| Rejected: Coverage evenness skew score above cutoff. | |||||||||||
TTACTTCGCTGAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ < minE/2068729‑2068717‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑AAGATGGAAAAAACGGCGGAAA > minE/2786335‑2786356 |||| TTACTTCGCTGATACTGAAGATGGAAAAAACGGTGGAAA < 1:4478137/39‑1TTACTTCGCTGATACTGAAGATGGAAAAAACGGTGGAAA < 1:5133497/39‑1TTACTTCGCTGATACTGAAGATGGAAAAAACGGTGGAAA > 1:912862/1‑39 ACTTCGCTGATACTGAAGATGGAAAAAACGGTGGAAA > 1:4777951/1‑37 ACTTCGCTGATACTGAAGATGGAAAAAACGGTGGAAA > 1:539980/1‑37 |||| TTACTTCGCTGAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ < minE/2068729‑2068717‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑AAGATGGAAAAAACGGCGGAAA > minE/2786335‑2786356 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |