| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | minE | = 2518066 | 49 (0.800) | 4 (0.080) +CTTGAGA |
3/84 | NT | 8.6% | coding (1009/2109 nt) | spoT | bifunctional (p)ppGpp synthetase II and guanosine‑3',5'‑bis pyrophosphate 3'‑pyrophosphohydrolase |
| ? | minE | 2715817 = | 51 (0.830) | intergenic (‑14/‑257) | tsgA/ppiA | predicted transporter/peptidyl‑prolyl cis‑trans isomerase A | |||||
| Rejected: Coverage evenness skew score above cutoff. | |||||||||||
TTTATAAGCCCAGTGCGC‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ > minE/2518049‑2518066‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑TCAAAAATAAAAT > minE/2715817‑2715829 ||||||| TTTATAAGCCCAGTACGCCTTGAGATCAAAAATAAAAT > 1:4631632/1‑38TTTATAAGCCCAGTACGCCTTGAGATCAAAAATAAAAT > 1:569724/1‑38TTTATAAGCCCAGTACGCCTTGAGATCAAAAATAAAAT < 1:779021/38‑1TTTATAAGCCCAGTACGCCTTGAGATCAAAAATAAA < 1:3440927/36‑1 ||||||| TTTATAAGCCCAGTGCGC‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ > minE/2518049‑2518066‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑TCAAAAATAAAAT > minE/2715817‑2715829 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |