New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	minE	= 2593949	46 (0.890)	3 (0.060)	3/100	NT	5.6%	intergenic (‑220/+921)	slp/arsC	outer membrane lipoprotein/arsenate reductase
	?	minE	= 2593974	57 (1.120)					intergenic (‑245/+896)	slp/arsC	outer membrane lipoprotein/arsenate reductase

TAATATAGTGCATTGTTTTAAAAGTACATAAAATCTATTTTTATTCA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  minE/2593903‑2593949 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑aTTGATTATTAGCACTTTATAATCATT  <  minE/2593974‑2593949                                                                           TAATATAGTGCATTGTTTTAAAAGTACATAAAATCTATTTTTATTCAATGATTATTAGCACTTTATAATCA    >  1:2019619/1‑71       AGTGCATTGTTTTAAAAGTACATAAAATCTATTTTTATTCATTGATTATTAGCACTTTATAATCAT   <  1:1550608/66‑1         TGCATTGTTTTAAAAGTACATAAAATCTATTTTTATTCATTGATTATTAGCACTTTATAATCATT  >  1:1662134/1‑65                                                                           TAATATAGTGCATTGTTTTAAAAGTACATAAAATCTATTTTTATTCA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  minE/2593903‑2593949 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑aTTGATTATTAGCACTTTATAATCATT  <  minE/2593974‑2593949

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.