| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | W3110S.gb | 1797170 = | 43 (1.080) | 5 (0.150) +GTGTAGAT |
3/84 | NT | 14.4% | coding (97/300 nt) | ihfA | integration host factor (IHF), DNA‑binding protein, alpha subunit |
| ? | W3110S.gb | = 2860280 | 28 (0.700) | coding (195/909 nt) | ygbJ | predicted dehydrogenase, with NAD(P)‑binding Rossmann‑fold domain | |||||
| Rejected: Coverage evenness skew score above cutoff. | |||||||||||
GAACTGTTTTTCGAAG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ < W3110S.gb/1797185‑1797170‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑GTCCAGTTTTTCG < W3110S.gb/2860280‑2860268 |||||||| GAACTGTTTTTTGAAGGTGTAGATGTCCAGTTTTTCG > 1:2379674/1‑37GAACTGTTTTTTGAAGGTGTAGATGTCCAGTTTTTCG < 1:3050070/37‑1GAACTGTTTTTTGAAGGTGTAGATGTCCAGTTTTT < 1:1531230/35‑1GAACTGTTTTTTGAAGGTGTAGATGTCCAGTTTTT < 1:1555339/35‑1GAACTGTTTTTTGAAGGTGTAGATGTCCAGTTTTT < 1:2222320/35‑1 |||||||| GAACTGTTTTTCGAAG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ < W3110S.gb/1797185‑1797170‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑GTCCAGTTTTTCG < W3110S.gb/2860280‑2860268 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |