| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | W3110S.gb | = 3285126 | 67 (1.460) | 7 (0.180) +CGGTTGTG |
4/80 | NT | 14.1% | coding (587/804 nt) | agaC | N‑acetylgalactosamine‑specific enzyme IIC component of PTS |
| ? | W3110S.gb | 3380815 = | 35 (0.760) | coding (218/1368 nt) | degQ | serine endoprotease, periplasmic | |||||
TGCCGTTGGTTTTGGCTT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ > W3110S.gb/3285109‑3285126‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑AAAAGTTTTTTGGTGATGATTT > W3110S.gb/3380815‑3380836 |||||||| atCCGTTGGTTTTGGTTTCGGTTGTGAAAAGTTTTTTGGT < 1:1854272/38‑1 CCGTTGGTTTTGGTTTCGGTTGTGAAAAGTTTTTTGGTa > 1:3248023/1‑38 CCGTTGGTTTTGGTTTCGGTTGTGAAAAGTTTTTTGG > 1:1992951/1‑37 CCGTTGGTTTTGGTTTCGGTTGTGAAAAGTTTTTTGG < 1:3718929/37‑1 CGTTGGTTTTGGTTTCGGTTGTGAAAAGTTTTTTGGT‑ATGAT > 1:3673668/1‑42 GGTTTTGGTTTCGGTTGTGAAAAGTTTTTTGGT‑ATGATat > 1:3484221/1‑38 GGTTTTGGTTTCGGTTGTGAAAAGTTTTTTGGT‑ATGAT < 1:4034365/38‑1 |||||||| TGCCGTTGGTTTTGGCTT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ > W3110S.gb/3285109‑3285126‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑AAAAGTTTTTTGGTGATGATTT > W3110S.gb/3380815‑3380836 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |