Predicted mutation
evidence	seq id	position	mutation	freq	annotation	gene	description
RA	minE	1,600,586	Δ5 bp	100%	coding (856‑860/1425 nt)	murP →	fused predicted enzyme IIBC components of PTS

Read alignment evidence...
	seq id	position		ref	new	freq	score (cons/poly)	reads	annotation	genes	product
*	minE	1,600,586	0	A	.	100.0%	29.7 / NA	8	coding (856/1425 nt)	murP	fused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base A (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*	minE	1,600,587	0	T	.	100.0%	29.7 / NA	8	coding (857/1425 nt)	murP	fused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base T (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*	minE	1,600,588	0	G	.	100.0%	29.7 / NA	8	coding (858/1425 nt)	murP	fused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base G (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*	minE	1,600,589	0	T	.	100.0%	29.7 / NA	8	coding (859/1425 nt)	murP	fused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base T (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.
*	minE	1,600,590	0	C	.	100.0%	29.7 / NA	8	coding (860/1425 nt)	murP	fused predicted enzyme IIBC components of PTS
Reads supporting (aligned to +/- strand):  ref base C (0/0);  new base . (8/0);  total (8/0)
Rejected as polymorphism: Frequency below/above cutoff threshold.
Rejected as polymorphism: Variant not supported by required number of reads on each strand.

GCCGCTGGGTGGCTGGTTATTCGAAGGTATGTCATGGCTGTTTATGCACCTGAACAGTAATC  >  minE/1600558‑1600619                             |||||                              gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTaa    >  1:32821/1‑55 (MQ=255) gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:1044091/1‑57 (MQ=255) gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:1069841/1‑57 (MQ=255) gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:171714/1‑57 (MQ=255) gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:2095591/1‑57 (MQ=255) gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:2194277/1‑57 (MQ=255) gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:316430/1‑57 (MQ=255) gCCGCTGGGTGGCTGGTTATTCGAAGGT‑‑‑‑‑ATGGCTGTTTATGCACCTGAACAGTAATc  >  1:758857/1‑57 (MQ=255)                             |||||                              GCCGCTGGGTGGCTGGTTATTCGAAGGTATGTCATGGCTGTTTATGCACCTGAACAGTAATC  >  minE/1600558‑1600619

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 21 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑