New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	minE	= 95243	93 (1.550)	9 (0.190) +TGATCCGGTA	3/78	NT	10.3%	coding (2225/2706 nt)	secA	preprotein translocase subunit, ATPase that targets protein precursors to the SecYE core translocon
	?	minE	= 2270306	105 (1.750)					coding (25/1029 nt)	murB	UDP‑N‑acetylenolpyruvoylglucosamine reductase, FAD‑binding

TGAGCGCATTCTGGCGCA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  minE/95226‑95243 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑AACACATTTGGCATTGATCA  <  minE/2270306‑2270287                   ||||||||||                     acAGCGCATTCTGGCGCATGATCCGGTAAACACGTTTGGCATTG      <  1:1377323/42‑1   AGCGCATTCTGGCGCATGATCCGGTAAACACGTTTGGCATTGAT    >  1:1109193/1‑44    GCGCATTCTGGCGCATGATCCGGTAAACACGTTTGGCATTGAT    >  1:1367005/1‑43    GCGCATTCTGGCGCATGATCCGGTAAACACGTTTGGC          >  1:2980975/1‑37         TTCTGGCGCATGATCCGGTAAACACGTTTGTCATTGATCg  <  1:1093956/40‑2         TTCTGGCGCATGATCCGGTAAACACGTTTGGCATTGATCg  <  1:2024873/40‑2         TTCTGGCGCATGATCCGGTAAACACGTTTGGCATTGATCg  <  1:2891184/40‑2         TTCTGGCGCATGATCCGGTAAACACGTTTGGCATTGATCg  <  1:3798034/40‑2            TGGCGCATGATCCGGTAAACACGTTTGGCATTGAT    >  1:721638/1‑35                   ||||||||||                     TGAGCGCATTCTGGCGCA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  minE/95226‑95243 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑AACACATTTGGCATTGATCA  <  minE/2270306‑2270287

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.