New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	minE	1361030 =	64 (1.320)	3 (0.060)	3/100	NT	4.6%	intergenic (‑23/+240)	yehE/mrp	hypothetical protein/antiporter inner membrane protein
	?	minE	1361061 =	61 (1.260)					intergenic (‑54/+209)	yehE/mrp	hypothetical protein/antiporter inner membrane protein
Rejected: Frequency below/above cutoff threshold.

TTGTTATGCACTCATTCTATCCAGGCATAACC‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  minE/1361061‑1361030 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑AACTATAGCTGTACATCCACTACACAGCCACGAAGGATGAT  >  minE/1361061‑1361101                                                                           TTGTTATGCACTCATTCTATCCAGGCATAACCAACTATAGCTGTACATCCACTACACAGCCACGAAGGAT     >  1:2775783/1‑70    TTATGCACTCATTCTATCCAGGCATAACCAACTATAGCTGTACATCCACTACACAGCCACGAAGGATGAT  <  1:1289569/70‑1      ATGCACTCATTCTATCCAGGCATAACAAACTATAGCTGTACATCCACTA                     <  1:1558696/49‑1                                                                           TTGTTATGCACTCATTCTATCCAGGCATAACC‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  minE/1361061‑1361030 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑AACTATAGCTGTACATCCACTACACAGCCACGAAGGATGAT  >  minE/1361061‑1361101

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.