New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? AP009048 4463108 =99 (1.220)4 (0.050) 3/96 NT 3.6% coding (470/1353 nt) pmbA predicted peptidase required for the maturation and secretion of the antibiotic peptide MccB17
?AP009048 4463145 = 117 (1.470)coding (507/1353 nt) pmbA predicted peptidase required for the maturation and secretion of the antibiotic peptide MccB17
Rejected: Frequency below/above cutoff threshold.

TGACACCGTAGTGGCTGTTAAAGCTGCCACCTTCGGTAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  AP009048/4463146‑4463108
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑tCAAAGTTTTTGGCAACAGCCACGGCATGTTGCAGGGTTACTGCTCAACGCGTCATTCGCTCTCCAGCTGT  >  AP009048/4463145‑4463214
                                                                                                             
TGACACCGTAGTGGCTGTTAAAGCTGCCACCTTCGGTATCAAAGTTTTTGGCAACAGCCACGGCATGTTG                                         >  1:1758559/1‑70
        TAGTGGCTGTTAAAGCTGCCACCTTCGGTATCAAAGTTTTTGGC                                                           <  1:4096586/44‑1
         AGTGGCTGTTAAAGCTGCCACCTTCGGTATCAAAGTTTTTGGCAA                                                         >  1:1906706/1‑45
         AGTGGCTGTTAAAGCTGCCACCTTCGGTATCAAAGTTTTTGGCAA                                                         >  1:910260/1‑45
                                      TCAAAGTTTTTGGCAACAGCCACGGCATGTTGCAGGGTTACTGCTCAACGCGTCATTCGCTCTCCAGCTGT  >  1:1089655/1‑71
                                      TCAAAGTTTTTGGCAACAGCCACGGCATGTTGCAGGGTTACTGCTCAACGCGTCATTCGCTCTCCAGCTGT  >  1:74149/1‑71
                                                                                                             
TGACACCGTAGTGGCTGTTAAAGCTGCCACCTTCGGTAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  AP009048/4463146‑4463108
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑tCAAAGTTTTTGGCAACAGCCACGGCATGTTGCAGGGTTACTGCTCAACGCGTCATTCGCTCTCCAGCTGT  >  AP009048/4463145‑4463214

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.