New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	Exported	122444 =	39 (0.640)	6 (0.120) +GGTAGAGTAC	3/78	NT	9.3%	coding (622/1551 nt)	cueO	multicopper oxidase (laccase)
	?	Exported	= 2498641	109 (1.780)					coding (1181/1689 nt)	ilvB	acetolactate synthase I, large subunit

ATCGCCAAACCAGCC‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  Exported/122458‑122444 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑TGCTGACCAACGT  <  Exported/2498641‑2498629                ||||||||||              ATCGCCAAACCAGCCGGTAGAGTACTGCTGACCAACGT  <  1:136032/38‑1 ATCGCCAAACCAGCCGGTAGAGTACTGCTGACCAA     >  1:489398/1‑35  TCGCCAAACCAGCCGGTAGAGTACTGCTGACCAACGT  <  1:1344438/37‑1  TCGCCAAACCAGCCGGTAGAGTACTGCTGACCAACGT  <  1:160866/37‑1  TCGCCAAACCAGCCGGTAGAGTACTGCTGACCAACGT  <  1:4045669/37‑1  TCGCCAAACCAGCCGGTAGAGTACTGCTGACCAACGT  >  1:5553900/1‑37                ||||||||||              ATCGCCAAACCAGCC‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  Exported/122458‑122444 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑TGCTGACCAACGT  <  Exported/2498641‑2498629

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.