New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? Exported = 66272186 (1.400)4 (0.080)
+TCTCGGCA
3/82 NT 5.8% coding (71/543 nt) ycbW hypothetical protein
?Exported 2124983 = 71 (1.160)coding (20/444 nt) yhbP conserved hypothetical protein

ATGATGCTCGATTT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  Exported/662708‑662721
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATGGCGATGAGTGTTTCC  >  Exported/2124983‑2125000
              ||||||||                  
ATGATGCTCGATTTTCTCGGCAATGGCGATGAGCGTTTC   <  1:600848/39‑1
 TGATGCTCGATTTTCTCGGCAATGGCGATGAGCGTTTCC  <  1:2802734/39‑1
 TGATGCTCGATTTTCTCGGCAATGGCGATGAGCGTTTCC  <  1:4139731/39‑1
  GATGCTCGATTTTCTCGGCAATGGCGATGAGCGTTTC   >  1:5187417/1‑37
              ||||||||                  
ATGATGCTCGATTT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  Exported/662708‑662721
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATGGCGATGAGTGTTTCC  >  Exported/2124983‑2125000

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.