New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	Exported	= 662721	86 (1.400)	4 (0.080) +TCTCGGCA	3/82	NT	5.8%	coding (71/543 nt)	ycbW	hypothetical protein
	?	Exported	2124983 =	71 (1.160)					coding (20/444 nt)	yhbP	conserved hypothetical protein

ATGATGCTCGATTT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  Exported/662708‑662721 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATGGCGATGAGTGTTTCC  >  Exported/2124983‑2125000               ||||||||                   ATGATGCTCGATTTTCTCGGCAATGGCGATGAGCGTTTC   <  1:600848/39‑1  TGATGCTCGATTTTCTCGGCAATGGCGATGAGCGTTTCC  <  1:2802734/39‑1  TGATGCTCGATTTTCTCGGCAATGGCGATGAGCGTTTCC  <  1:4139731/39‑1   GATGCTCGATTTTCTCGGCAATGGCGATGAGCGTTTC   >  1:5187417/1‑37               ||||||||                   ATGATGCTCGATTT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  Exported/662708‑662721 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATGGCGATGAGTGTTTCC  >  Exported/2124983‑2125000

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.