New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? Exported 1710515 =48 (0.780)6 (0.110)
+GGGTAT
3/86 NT 10.7% coding (533/1512 nt) yphE fused predicted sugar transporter subunits and ATP‑binding components of ABC superfamily
?Exported = 2983235 66 (1.080)coding (250/1425 nt) creC sensory histidine kinase in two‑component regulatory system with CreB or PhoB, regulator of the CreBC regulon
Rejected: Coverage evenness skew score above cutoff.

GTCATTCTTGATGAACCTACCAG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  Exported/1710537‑1710515
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑CGATATTGGCGCGA  <  Exported/2983235‑2983222
                       ||||||              
cTCATTCTTGATGAACCCACCAGGGGTATCGATATTGGCGCGA  <  1:5204709/42‑1
 TCATTCTTGATGAACCCACCAGGGGTATCGATATTGGCGCGA  <  1:3854347/42‑1
   ATTCTTGATGAACCCACCAGGGGTATCGATATTGGCGCGA  >  1:3535657/1‑40
   ATTCTTGATGAACCCACCAGGGGTATCGATATTGGCGCGA  >  1:3793357/1‑40
   ATTCTTGATGAACCCA‑CAGGGGTATCGATATTGGCGCGA  >  1:4994910/1‑39
       TTGATGAACCCACCAGGGGTATCGATATTGGCGCGA  >  1:4053519/1‑36
                       ||||||              
GTCATTCTTGATGAACCTACCAG‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  Exported/1710537‑1710515
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑CGATATTGGCGCGA  <  Exported/2983235‑2983222

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.