New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	Exported	142010 =	25 (0.420)	6 (0.100)	3/102	NT	16.2%	coding (463/480 nt)	folK	2‑amino‑4‑hydroxy‑6‑hydroxymethyldihyropteridine pyrophosphokinase
	?	Exported	142041 =	37 (0.630)					coding (432/480 nt)	folK	2‑amino‑4‑hydroxy‑6‑hydroxymethyldihyropteridine pyrophosphokinase

TGCGTCAAATCTTACATACAAGAGCATTTGACA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  Exported/142042‑142010 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑CAACATCTCCCCATCAGGAAACACCAACTCCGGCGCGATT  >  Exported/142041‑142080                                                                           TGCGTCAAATCTTACATACAAGAGCATTTGACACAACATCTCCCCATCAGGAAACACCAACTCCGGCGC      >  1:3281139/1‑69    GTCAAATCTTACATACAAGAGCATTTGACACAACATCTCCCCATCAGGAAACACCAACTCCGGCGCGA    <  1:1647727/68‑1    GTCAAATCTTACATACAAGAGCATTTGACACAACATCTCCCCATCAGGAAACACCAACTCCGGCGCGA    <  1:2192475/68‑1    GTCAAATCTTACATACAAGAGCATTTGACACAACATCTCCCCATCAGGAAACACCAACTCCGGCGCGA    <  1:2428645/68‑1    GTCAAATCTTACATACAAGAGCATTTGACACAACATCTCCCCATCAGGAAACACCAACTCCGGCGCGA    <  1:685588/68‑1      CAAATCTTACATACAAGAGCATTTGACACAACATCTCCCCATCAGGAAACACCAACTCCGGCGCGATT  >  1:446205/1‑68                                                                           TGCGTCAAATCTTACATACAAGAGCATTTGACA‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  <  Exported/142042‑142010 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑CAACATCTCCCCATCAGGAAACACCAACTCCGGCGCGATT  >  Exported/142041‑142080

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.