New junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? Exported = 207008987 (1.470)6 (0.100) 3/102 NT 6.4% intergenic (‑300/‑91) aer/ygjG fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component/putrescine:2‑oxoglutaric acid aminotransferase, PLP‑dependent
?Exported = 2070114 88 (1.490)intergenic (‑325/‑66) aer/ygjG fused signal transducer for aerotaxis sensory component and methyl accepting chemotaxis component/putrescine:2‑oxoglutaric acid aminotransferase, PLP‑dependent

AACCGTGCAAAATAACAACAAATGTTAACAGATAGCATTAAATATT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  Exported/2070044‑2070089
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ACACAAATTCGGTTATCATTTGTGC  <  Exported/2070114‑2070090
                                                                       
AACCGTGCAAAATTACAACAAATGTTAACAGATAGCATTAAATATTACACAAATTCGGTTATCATTTGTGC  <  1:2519707/71‑1
AACCGTGCAAAATAACAACAAATGTTAACAGATAGCATTAAATATTACACAAATTCGGTTATCATTTGTGC  <  1:3732365/71‑1
                       GTTAACAGATAGCATTAAATATTACACAAATTCGGTTATC          <  1:111189/40‑1
                       GTTAACAGATAGCATTAAATATTACACAAATTCGGTTATC          <  1:1908181/40‑1
                       GTTAACAGATAGCATTAAATATTACACAAATTCGGTTATC          <  1:2375042/40‑1
                          AACAGATAGCATTAAATATTACACAAATTCGGTTATCATTTGTG   >  1:523515/1‑44
                                                                       
AACCGTGCAAAATAACAACAAATGTTAACAGATAGCATTAAATATT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  Exported/2070044‑2070089
‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ACACAAATTCGGTTATCATTTGTGC  <  Exported/2070114‑2070090

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap:     Deleted base: 
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.