| Predicted mutation | |||||||
|---|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | freq | annotation | gene | description |
| JC JC | NC_000913 | 4,542,238 | IS1 (–) +8 bp | 5.0% | coding (202‑209/597 nt) | fimE → | regulator for fimA |
| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 1978503 = | NA (NA) | 9 (0.080) | 9/176 | NT | 6.2% | noncoding (768/768 nt) | IS1 | repeat region |
| ? | NC_000913 | = 4542245 | 123 (1.170) | coding (209/597 nt) | fimE | regulator for fimA | |||||
| * | ? | NC_000913 | 3583428 = | NA (NA) | 4 (0.040) | 4/174 | NT | 2.9% | noncoding (1/768 nt) | IS1 | repeat region |
| ? | NC_000913 | 4542238 = | 122 (1.180) | coding (202/597 nt) | fimE | regulator for fimA | |||||
| Rejected: Frequency below/above cutoff threshold. | |||||||||||
ATGGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTT > NC_000913/1978500‑1978598 | ctGGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACtt < 1:1110715/98‑1 (MQ=17) | ATGGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTT > NC_000913/1978500‑1978598 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG < 39 ≤ ATCG/ATCG < 40 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |