breseq  version 0.35.4  revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log

Predicted mutations
evidence position mutation annotation gene description
MC JC 257,908 Δ776 bp insB9[crl] insB9, insA9, [crl]
RA 324,886 T→G Y160S (TAC→TCC)  ykgH ← uncharacterized protein YkgH
RA 889,923 A→G intergenic (‑104/‑166) ybjL ← / → ybjM putative transport protein YbjL/putative inner membrane protein
RA 1,196,220 C→T H366H (CAC→CAT icd → isocitrate dehydrogenase
RA 1,196,232 C→T T370T (ACC→ACT icd → isocitrate dehydrogenase
RA 1,196,245 T→C L375M (TTA→CTG)  icd → isocitrate dehydrogenase
RA 1,196,247 A→G L375M (TTA→CTG icd → isocitrate dehydrogenase
RA 1,415,149 A→G R746R (CGT→CGC recE ← Rac prophage; exonuclease VIII, ds DNA exonuclease, 5' ‑‑> 3' specific
JC JC 1,476,423 IS2 (+) +5 bp coding (1280‑1284/2307 nt) ydbD → DUF2773 domain‑containing protein YdbD
JC 1,707,146 (CAGCCGCTTACCCGTGGTCGCGGC)1→2 coding (228/2223 nt) rsxC → SoxR [2Fe‑2S] reducing system protein RsxC
JC JC 1,879,829 Δ1 bp :: IS186 (–) +6 bp :: Δ1 bp coding (115‑120/360 nt) yeaR ← DUF1971 domain‑containing protein YeaR
RA 1,921,909 T→A W44R (TGG→AGG)  yebV → protein YebV
MC JC 1,978,503 Δ776 bp insB‑5insA‑5 insB‑5, insA‑5
RA 2,133,868 A→T A595A (GCT→GCA wzc ← protein‑tyrosine kinase Wzc
RA 2,173,363 Δ2 bp pseudogene (915‑916/1358 nt) gatC ← galactitol‑specific PTS enzyme IIC component
RA 3,354,487 C→T intergenic (‑437/‑238) yhcC ← / → gltB radical SAM family oxidoreductase YhcC/glutamate synthase subunit GltB
RA 3,560,455 +G pseudogene (151/758 nt) glpR ← DNA‑binding transcriptional repressor GlpR
RA 3,815,883 +C coding (667/687 nt) rph ← truncated RNase PH
RA 4,296,381 +GC intergenic (+587/+55) gltP → / ← yjcO glutamate/aspartate : H(+) symporter GltP/Sel1 repeat‑containing protein YjcO

Unassigned missing coverage evidence
   seq id start end size ←reads reads→ gene description
* * ÷ NC_000913 1196270 1211442 15173 22 [17] [16] 20 [icd]–[icdC] [icd],ymfD,ymfE,lit,intE,xisE,ymfH,ymfI,ymfJ,ymfK,ymfT,ymfL,ymfM,oweE,ymfN,aaaE,ymfR,beeE,jayE,ymfQ,ycfK,tfaP,tfaE,stfE,pinE,mcrA,[icdC]
* * ÷ NC_000913 3423768–3424234 3424530–3424239 6–763 21 [18] [17] 20 [rrfD]–[rrlD] [rrfD],[rrlD]

Unassigned new junction evidence
  seq id position reads (cov) reads (cov) score skew freq annotation gene product
* ? NC_000913 = 12994980 (0.000)56 (0.860) 38/266 0.5 100% intergenic (+253/‑33) ychE/insH21 putative inner membrane protein/IS5 transposase and trans‑activator
?NC_000913 1300698 = 0 (0.000)intergenic (+151/‑484) insH21/oppA IS5 transposase and trans‑activator/oligopeptide ABC transporter periplasmic binding protein
* ? NC_000913 3363001 =106 (1.570)86 (1.280) 49/272 0.2 61.8% coding (195/2382 nt) yhcD putative fimbrial usher protein YhcD
?NC_000913 3766087 = 1 (0.010)coding (3905/4134 nt) rhsA rhs element protein RhsA
* ? NC_000913 = 3653230NA (NA)75 (1.110) 52/274 0.2 94.9% noncoding (1/1195 nt) IS5 repeat region
?NC_000913 = 3766089 4 (0.060)coding (3907/4134 nt) rhsA rhs element protein RhsA