New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	CP009273	= 20151	NA (NA)	4 (0.010)	3/88	NT	NA	noncoding (413/768 nt)	IS1	repeat region
	?	CP009273	= 275217	NA (NA)					noncoding (425/768 nt)	IS1	repeat region

GCTGGCGCGATTTAGCCCCGACATAGCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACT  >  CP009273/20146‑20212      |                                                              gcgggCGCGATTTAGCCCCGACATAGCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACt  <  1:41819191/64‑1 (MQ=1)      |                                                              GCTGGCGCGATTTAGCCCCGACATAGCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACT  >  CP009273/20146‑20212

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 15 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.