New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	CP009273	= 20197	NA (NA)	4 (0.010)	3/100	NT	NA	noncoding (367/768 nt)	IS1	repeat region
	?	CP009273	= 275301	NA (NA)					noncoding (341/768 nt)	IS1	repeat region

GCTGGCGCGATTTAGCCCCGACATAGCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACT  >  CP009273/20146‑20212                                                    |                gcgggCGCGATTTAGCCCCGACATAGCGCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACt  <  1:34709919/64‑1 (MQ=0)                                                    |                GCTGGCGCGATTTAGCCCCGACATAGCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACT  >  CP009273/20146‑20212

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 15 ≤ ATCG/ATCG < 21 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.