| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | 19693 = | 145 (1.310) | 9 (0.130) +ATAGAGGAATCTGATTACTTCCTTCATGGGGATGCTGAAAAGAGTAGTAATTGCT |
3/190 | 12.1 | 8.9% | intergenic (+73/+118) | nhaR/insB1 | transcriptional activator of nhaA/IS1 transposase B |
| ? | NC_000913 | 257908 = | NA (NA) | noncoding (768/768 nt) | IS1 | repeat region | |||||
| Rejected: Coverage evenness skew score above cutoff. | |||||||||||
| Rejected: Frequency below/above cutoff threshold. | |||||||||||
No reads uniquely aligned to region.