| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913 | = 1978502 | 0 (0.000) | 14 (0.180) | 14/282 | 4.5 | 100% | intergenic (‑305/+16) | flhD/insB1 | flagellar class II regulon transcriptional activator, with FlhC/IS1 transposase B |
| ? | NC_000913 | 1979279 = | 0 (0.000) | intergenic (‑64/‑474) | insA/uspC | IS1 repressor TnpA/universal stress protein | |||||
| Rejected: Position hash score below cutoff. | |||||||||||
ATAGAAATGGGTCTTTACACTTATCTAAGATTTTTCCTAAATCGACGCAACTGTACTCGTCACTACACGCACATACAACGGAGGGGGGCTGCGATTTTCAATAATGCGTGATGCAGATCACACAAAACACTCAATTACTTAACATAAATG > NC_000913/1978353‑1978502 |aTAGAAATGGGTCTTTACACTTATCTAAGATTTTTCCTAAATCGACGCAACTGTACTCGTCACTACACGCACATACAACGGAGGGGGGCTGCGATTTTCAATAATGCGTGATGCAGATCACACAAAACACTCAATTACTTAACATAAATg < 4:213460/150‑1 (MQ=255) |ATAGAAATGGGTCTTTACACTTATCTAAGATTTTTCCTAAATCGACGCAACTGTACTCGTCACTACACGCACATACAACGGAGGGGGGCTGCGATTTTCAATAATGCGTGATGCAGATCACACAAAACACTCAATTACTTAACATAAATG > NC_000913/1978353‑1978502 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 11 ≤ ATCG/ATCG < 24 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 38 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |