Predicted mutation | ||||||
---|---|---|---|---|---|---|
evidence | seq id | position | mutation | annotation | gene | description |
JC JC | NC_000913 | 1,293,033 | IS1 (+) +9 bp | intergenic (‑111/‑486) | hns ← / → tdk | global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase |
New junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | NC_000913 | 1293033 = | 0 (0.000) | 106 (0.970) | 52/296 | 0.5 | 100% | intergenic (‑111/‑494) | hns/tdk | global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase |
? | NC_000913 | 1978503 = | NA (NA) | noncoding (768/768 nt) | IS1 | repeat region | |||||
* | ? | NC_000913 | = 1293041 | 0 (0.000) | 109 (0.990) | 62/296 | 0.2 | 100% | intergenic (‑119/‑486) | hns/tdk | global DNA‑binding transcriptional dual regulator H‑NS/thymidine kinase/deoxyuridine kinase |
? | NC_000913 | = 1979270 | NA (NA) | noncoding (1/768 nt) | IS1 | repeat region |
CCATAAATGTATAAGTCATACTTTTGTTTTGGGTGTATTTCAATCTGTTAAAAAGTTTTTCGCTACGCTAGCAAGCAAAAATGAAACAGGAATAATCGAAATGGGATGTTGCGCACAGTCAAAATAACTCACCGTAAATAATCATCTGCTA > NC_000913/1979270‑1979420 | ccATAAATGTATAAGTCATACTTTTGTTTTGGGTGTATTTCAATCTGTTAAAAAGTTTTTCGCTACGCTAGCACGCAAAAATGAAACAGGAATAATCGAAATGGGATGTTGCGCACAGTCAAAATAACTCACCGTAAATAATCATCTGCta > 1:851215/1‑151 (MQ=255) | CCATAAATGTATAAGTCATACTTTTGTTTTGGGTGTATTTCAATCTGTTAAAAAGTTTTTCGCTACGCTAGCAAGCAAAAATGAAACAGGAATAATCGAAATGGGATGTTGCGCACAGTCAAAATAACTCACCGTAAATAATCATCTGCTA > NC_000913/1979270‑1979420 |
Alignment Legend |
---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 15 ≤ ATCG/ATCG < 16 ≤ ATCG/ATCG < 33 ≤ ATCG/ATCG < 38 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
Reads not counted as support for junction |
read_name Not counted due to insufficient overlap past the breakpoint. |
read_name Not counted due to not crossing MOB target site duplication. |