New junction evidence | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
* | ? | NC_000913_3_bme_pgi | 4296208 = | NA (NA) | 6 (0.180) | 6/268 | 3.7 | 17.4% | noncoding (373/600 nt) | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites |
? | NC_000913_3_bme_pgi | 4296399 = | 30 (0.840) | noncoding (564/600 nt) | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | RIP321 (repetitive extragenic palindromic) element; contains 11 REP sequences and 4 IHF sites | |||||
Rejected: Coverage evenness skew score above cutoff. | |||||||||||
Rejected: Frequency below/above cutoff threshold. |
CGACGCTTAACGCGTCTTATCAGGCCTACGCCAGACAGCGCAATAGCCTGATTTAGCGTGATTTTGTAGGTCGGATAAGGCGTTTATGCCGCATCCGACATCAACGCCTGATGCGAC > NC_000913_3_bme_pgi/4296183‑4296299 | cGACGCTTAACGCGTCTTATCAGGCCTACGCCAGACAGCGCAATAGCCTGATTTAGCGTGATTTTGTAGGTCGGATAAGGCGTTTATGCCGCATCCGACATCAACGCCTGATGCGAc > 2:359810/1‑117 (MQ=32) | CGACGCTTAACGCGTCTTATCAGGCCTACGCCAGACAGCGCAATAGCCTGATTTAGCGTGATTTTGTAGGTCGGATAAGGCGTTTATGCCGCATCCGACATCAACGCCTGATGCGAC > NC_000913_3_bme_pgi/4296183‑4296299 |
Alignment Legend |
---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 37 ≤ ATCG/ATCG < 38 ≤ ATCG/ATCG < 41 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
Reads not counted as support for junction |
read_name Not counted due to insufficient overlap past the breakpoint. |
read_name Not counted due to not crossing MOB target site duplication. |