| New junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_000913_3_hsa_pgi | 257908 = | NA (NA) | 23 (0.230) | 23/296 | 5.1 | 24.7% | intergenic (+9/‑768) | crl/crl | pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers/pseudogene, sigma factor‑binding protein, RNA polymerase holoenzyme formation stimulator;regulator; Surface structures; transcriptional regulator of cryptic csgA gene for curli surface fibers |
| ? | NC_000913_3_hsa_pgi | = 314992 | 70 (0.690) | pseudogene (636/872 nt) | eaeH | pseudogene, attaching and effacing protein homology;factor; Not classified | |||||
| Rejected: Coverage evenness skew score above cutoff. | |||||||||||
TTAAAAATTTGCTAAATTTTGCCAATTTGGTAAAACAGTTGCATCACAACAGGAGATAGCAATGACGTTACCGAGTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTAATGAC > NC_000913_3_hsa_pgi/257768‑257916 | ttAAAAATATGCTAAAATTTGCCAATTTGGTAAAACAGTTGAATCACAACAGGAGATAGAAATGACTTTACAGAGAGGACACCCGAAGAGCAGATTTATCAAAAAATTTAACGAAATAAGCCCGTATATTCGTTAaggtaagtgcaaaa > 1:165318/1‑143 (MQ=255) | TTAAAAATTTGCTAAATTTTGCCAATTTGGTAAAACAGTTGCATCACAACAGGAGATAGCAATGACGTTACCGAGTGGACACCCGAAGAGCAGATTGATCAAAAAATTTACCGCACTAGGCCCGTATATTCGTGAAGGTAGGTAATGAC > NC_000913_3_hsa_pgi/257768‑257916 |
| Alignment Legend |
|---|
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 14 ≤ ATCG/ATCG < 15 ≤ ATCG/ATCG < 16 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG |
Unaligned base: atcg Masked matching base: atcg Alignment gap: ‑ Deleted base: ‑ |
| Reads not counted as support for junction |
| read_name Not counted due to insufficient overlap past the breakpoint. |
| read_name Not counted due to not crossing MOB target site duplication. |